TMCO3-transmembrane and coiled-coil domains 3 Gene View larger

TMCO3-transmembrane and coiled-coil domains 3 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TMCO3-transmembrane and coiled-coil domains 3 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TMCO3-transmembrane and coiled-coil domains 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012564
Product type: DNA & cDNA
Ncbi symbol: TMCO3
Origin species: Human
Product name: TMCO3-transmembrane and coiled-coil domains 3 Gene
Size: 2ug
Accessions: BC012564
Gene id: 55002
Gene description: transmembrane and coiled-coil domains 3
Synonyms: C13orf11; transmembrane and coiled-coil domain-containing protein 3; B230339H12Rik; testis tissue sperm-binding protein Li 36a; transmembrane and coiled-coil domains 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaggtgttgggaagaagcttcttctgggtgctgtttcccgtccttccctgggcggtgcaggctgtggagcacgaggaggtggcgcagcgtgtgatcaaactgcaccgcgggcgaggggtggctgccatgcagagccggcagtgggtccgggacagctgcaggaagctctcagggcttctccgccagaagaatgcagttctgaacaaactgaaaactgcaattggagcagtggagaaagacgtgggcctgtcggatgaagagaaactgtttcaggtgcacacgtttgaaattttccagaaagagctgaatgaaagtgaaaattccgttttccaagctgtctacggactgcagagagccctgcagggggattacaaagatgtcgtgaacatgaaggagagcagccggcagcgcctggaggccctgagagaggctgcaataaaggaagaaacagaatatatggaacttctggcagcagaaaaacatcaagttgaagcccttaaaaatatgcaacatcaaaaccaaagtttatccatgcttgacgagattcttgaagatgtaagaaaggcagcggatcgtctggaggaagagatagaggaacatgcttttgacgacaataaatcagtcaagggggtcaattttgaggcagttctgagggtggaggaagaagaggccaattctaagcaaaatataacaaaacgagaagtggaggatgacttgggtcttagcatgctgattgactcccagaacaaccagtatattttgaccaagcccagagattcaaccatcccacgtgcagatcaccactttataaaggacattgttaccataggaatgctgtccttgccttgtggctggctatgtacagccataggattgcctacaatgtttggttatattatttgtggtgtacttctgggaccttcaggactaaatagtattaagtctattgtgcaagtggagacattaggagaatttggggtgttttttactctttttcttgttggcttagaattttctccagaaaagctaagaaaggtgtggaagatttccttacaagggccgtgttacatgacactgttaatgattgcatttggcttgctgtgggggcatctcttgcggatcaaacccacgcagagcgtcttcatttccacgtgtctgtccttgtcaagcacacccctcgtgtccaggttcctcatgggcagtgctcggggtgacaaagaaggcaacagaacagccctctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - colony stimulating factor 1 (macrophage)
- poly(A) binding protein, cytoplasmic 3
- glutamate decarboxylase 1 (brain, 67kDa)
- DEAD (Asp-Glu-Ala-Asp) box polypeptide 4

Buy TMCO3-transmembrane and coiled-coil domains 3 Gene now

Add to cart