LAMP1-lysosomal-associated membrane protein 1 Gene View larger

LAMP1-lysosomal-associated membrane protein 1 Gene

PTXBC021288

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LAMP1-lysosomal-associated membrane protein 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about LAMP1-lysosomal-associated membrane protein 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC021288
Product type: DNA & cDNA
Ncbi symbol: LAMP1
Origin species: Human
Product name: LAMP1-lysosomal-associated membrane protein 1 Gene
Size: 2ug
Accessions: BC021288
Gene id: 3916
Gene description: lysosomal-associated membrane protein 1
Synonyms: CD107a; LAMPA; LGP120; lysosome-associated membrane glycoprotein 1; CD107 antigen-like family member A; lysosome-associated membrane protein 1; lysosomal associated membrane protein 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggcccccggcagcgcccggcgacccctgctgctgctactgctgttgctgctgctcggcctcatgcattgtgcgtcagcagcaatgtttatggtgaaaaatggcaacgggaccgcgtgcataatggccaacttctctgctgccttctcagtgaactacgacaccaagagtggccctaagaacatgacctttgacctgccatcagatgccacagtggtgctcaaccgcagctcctgtggaaaagagaacacttctgaccccagtctcgtgattgcttttggaagaggacatacactcactctcaatttcacgagaaatgcaacacgttacagcgtccagctcatgagttttgtttataacttgtcagacacacaccttttccccaatgcgagctccaaagaaatcaagactgtggaatctataactgacatcagggcagatatagataaaaaatacagatgtgttagtggcacccaggtccacatgaacaacgtgaccgtaacgctccatgatgccaccatccaggcgtacctttccaacagcagcttcagcaggggagagacacgctgtgaacaagacaggccttccccaaccacagcgccccctgcgccacccagcccctcgccctcacccgtgcccaagagcccctctgtggacaagtacaacgtgagcggcaccaacgggacctgcctgctggccagcatggggctgcagctgaacctcacctatgagaggaaggacaacacgacggtgacaaggcttctcaacatcaaccccaacaagacctcggccagcgggagctgcggcgcccacctggtgactctggagctgcacagcgagggcaccaccgtcctgctcttccagttcgggatgaatgcaagttctagccggtttttcctacaaggaatccagttgaatacaattcttcctgacgccagagaccctgcctttaaagctgccaacggctccctgcgagcgctgcaggccacagtcggcaattcctacaagtgcaacgcggaggagcacgtccgtgtcacgaaggcgttttcagtcaatatattcaaagtgtgggtccaggctttcaaggtggaaggtggccagtttggctctgtggaggagtgtctgctggacgagaacagcatgctgatccccatcgctgtgggtggtgccctggcggggctggtcctcatcgtcctcatcgcctacctcgtcggcaggaagaggagtcacgcaggctaccagactatctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - isocitrate dehydrogenase 3 (NAD+) gamma
- transmembrane and coiled-coil domains 3
- colony stimulating factor 1 (macrophage)
- poly(A) binding protein, cytoplasmic 3

Buy LAMP1-lysosomal-associated membrane protein 1 Gene now

Add to cart