RRM2-ribonucleotide reductase M2 polypeptide Gene View larger

RRM2-ribonucleotide reductase M2 polypeptide Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RRM2-ribonucleotide reductase M2 polypeptide Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about RRM2-ribonucleotide reductase M2 polypeptide Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001886
Product type: DNA & cDNA
Ncbi symbol: RRM2
Origin species: Human
Product name: RRM2-ribonucleotide reductase M2 polypeptide Gene
Size: 2ug
Accessions: BC001886
Gene id: 6241
Gene description: ribonucleotide reductase M2 polypeptide
Synonyms: RR2; RR2M; ribonucleoside-diphosphate reductase subunit M2; ribonucleotide reductase M2 polypeptide; ribonucleotide reductase small chain; ribonucleotide reductase small subunit; ribonucleotide reductase regulatory subunit M2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctctccctccgtgtcccgctcgcgcccatcacggacccgcagcagctgcagctctcgccgctgaaggggctcagcttggtcgacaaggagaacacgccgccggccctgagcgggacccgcgtcctggccagcaagaccgcgaggaggatcttccaggagcccacggagccgaaaactaaagcagctgcccccggcgtggaggatgagccgctgctgagagaaaacccccgccgctttgtcatcttccccatcgagtaccatgatatctggcagatgtataagaaggcagaggcttccttttggaccgccgaggaggtggacctctccaaggacattcagcactgggaatccctgaaacccgaggagagatattttatatcccatgttctggctttctttgcagcaagcgatggcatagtaaatgaaaacttggtggagcgatttagccaagaagttcagattacagaagcccgctgtttctatggcttccaaattgccatggaaaacatacattctgaaatgtatagtcttcttattgacacttacataaaagatcccaaagaaagggaatttctcttcaatgccattgaaacgatgccttgtgtcaagaagaaggcagactgggccttgcgctggattggggacaaagaggctacctatggtgaacgtgttgtagcctttgctgcagtggaaggcattttcttttccggttcttttgcgtcgatattctggctcaagaaacgaggactgatgcctggcctcacattttctaatgaacttattagcagagatgagggtttacactgtgattttgcttgcctgatgttcaaacacctggtacacaaaccatcggaggagagagtaagagaaataattatcaatgctgttcggatagaacaggagttcctcactgaggccttgcctgtgaagctcattgggatgaattgcactctaatgaagcaatacattgagtttgtggcagacagacttatgctggaactgggttttagcaaggttttcagagtagagaacccatttgactttatggagaatatttcactggaaggaaagactaacttctttgagaagagagtaggcgagtatcagaggatgggagtgatgtcaagtccaacagagaattcttttaccttggatgctgacttctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - solute carrier family 25, member 39
- WD repeat and FYVE domain containing 3
- chromosome 18 open reading frame 25
- X-linked Kx blood group (McLeod syndrome)

Buy RRM2-ribonucleotide reductase M2 polypeptide Gene now

Add to cart