XK-X-linked Kx blood group (McLeod syndrome) Gene View larger

XK-X-linked Kx blood group (McLeod syndrome) Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of XK-X-linked Kx blood group (McLeod syndrome) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about XK-X-linked Kx blood group (McLeod syndrome) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC036019
Product type: DNA & cDNA
Ncbi symbol: XK
Origin species: Human
Product name: XK-X-linked Kx blood group (McLeod syndrome) Gene
Size: 2ug
Accessions: BC036019
Gene id: 7504
Gene description: X-linked Kx blood group (McLeod syndrome)
Synonyms: XK-related protein 1; XK, Kell blood group complex subunit (McLeod syndrome); membrane transport protein XK; NAC; X1k; XKR1; Kell blood group precursor (McLeod phenotype); Kx antigen; kell complex 37 kDa component; X-linked Kx blood group
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaattcccggcctcggtgctggcgtccgtgttcctgttcgtggccgagacaacggcggcgctcagcctgagcagcacctaccgctcgggcggggaccgcatgtggcaggcgctgacgttgcttttctcgctactgccttgcgcgctcgtgcagctcacgcttctcttcgtacaccgcgacctcagccgcgaccgcccgctcgtactgctgctgcacctgctgcaacttgggccccttttcaggtgttttgaagtcttctgcatctactttcagtcaggcaacaatgaagagccttatgtcagtatcaccaagaagaggcaaatgccaaaaaatggcctctcagaggagattgagaaggaggtgggccaggcagaaggcaaactaatcacccaccgatcagcgttcagccgggcgtcggtgatccaggctttcttgggctcagccccccagctgaccctacagctgtacataagtgtcatgcagcaggacgtcactgttggaagaagtctcctcatgaccatatccctgttgtccattgtgtatggagccttgcgctgcaacatcctagccatcaaaatcaagtacgatgagtatgaagtcaaagtgaagcctctggcctatgtctgtatcttcctgtggaggagctttgagattgccactcgagttgtagtcctggtcctctttacctccgtcctgaagacctgggtggtggttataatactcatcaacttcttcagtttgttcttgtacccctggatcctcttctggtgcagtggttccccattccctgagaacatagagaaggccctcagtagagtgggcaccaccattgtactatgctttctaactttactctatactggtatcaacatgttctgctggtctgctgtacagctgaaaattgacagccctgacctcatcagcaagtcccataattggtaccagctactggtgtattacatgataagattcatcgagaatgccatcctcctcctcctgtggtatcttttcaagactgacatctatatgtatgtgtgcgcacctctgttggtcctgcagctgctcattgggtactgcacagccattctcttcatgcttgtattctatcagttcttccacccttgcaaaaagctcttttcttccagtgtttctgaaggctttcagaggtggctcaggtgtttttgctgggcctgcaggcagcaaaaaccctgtgagccgataggaaaggaagatctacagtcatccagagatagagatgagacaccttctagcagtaaaacaagtcctgagcctggtcagttcttgaatgctgaagatctctgctctgcttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - pancreatic lipase-related protein 2
- chromosome 9 open reading frame 102
- polypyrimidine tract binding protein 1
- chromosome 20 open reading frame 26

Buy XK-X-linked Kx blood group (McLeod syndrome) Gene now

Add to cart