C18orf25-chromosome 18 open reading frame 25 Gene View larger

C18orf25-chromosome 18 open reading frame 25 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C18orf25-chromosome 18 open reading frame 25 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C18orf25-chromosome 18 open reading frame 25 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC016149
Product type: DNA & cDNA
Ncbi symbol: C18orf25
Origin species: Human
Product name: C18orf25-chromosome 18 open reading frame 25 Gene
Size: 2ug
Accessions: BC016149
Gene id: 147339
Gene description: chromosome 18 open reading frame 25
Synonyms: uncharacterized protein C18orf25; ARKL1; RNF111L1; ARKadia-like 1; chromosome 18 open reading frame 25
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagatggaggaggcagtgggaaaagttgaagaactcattgagtccgaagccccaccaaaagcatctgaacaagagacagccaaggaggaagatggatctgtagaactggaatctcaagttcagaaagatggtgtagcggattctacagttatttcttcaatgccctgcttgttgatggaactgagaagggactcttctgagtctcagttagcatccacagagagtgacaagcctacaactggccgagtttatgagagtgactcctctaatcactgcatgctttccccttcctctagtggtcacctggctgattcagatacgttgtcttccgcagaagagaatgaaccctctcaggcagaaacggcggtagaaggagacccttcaggagtgtctggtgccacagttgggcgcaagtctaggcggtcccgatctgaaagtgaaacttccactatggctgccaagaaaaaccggcaatccagtgataaacagaatggccgagtcgccaaggttaaaggtcatcggagccaaaagcacaaggagaggatcaggctactgaggcagaaacgggaggctgctgcaaggaagaaatataacctgctgcaggacagtagtaccagtgatagtgacctgacttgtgactcaagcacgagctcatcagatgatgatgaagaggtttcagggagcagcaagacaatcactgcagagataccagatggacctccagttgtagctcattatgatatgtctgacaccaactctgacccagaagtggtaaatgtggacaatttattggcggctgcagtagttcaagagcacagtaattctgtaggcggccaggacacaggagctacctggaggaccagcgggcttctagaggagctgaatgcagaggcaggtcatttggatccaggattcctagcaagtgacaaaacatctgctggcaatgcgccactcaatgaagaaattaacattgcgtcttcagatagtgaagtagagattgtgggagttcaggaacatgcaaggtgtgttcatcctcgaggtggtgtgattcagagtgtttcttcatggaagcatggctcgggcacgcagtatgttagcaccaggcaaacacagtcatggactgctgtgactccccagcagacttgggcttcaccagcagaagttgttgaccttaccttggatgaggatagcaggcgtaaatacctactgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - X-linked Kx blood group (McLeod syndrome)
- pancreatic lipase-related protein 2
- chromosome 9 open reading frame 102
- polypyrimidine tract binding protein 1

Buy C18orf25-chromosome 18 open reading frame 25 Gene now

Add to cart