WDFY3-WD repeat and FYVE domain containing 3 Gene View larger

WDFY3-WD repeat and FYVE domain containing 3 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of WDFY3-WD repeat and FYVE domain containing 3 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about WDFY3-WD repeat and FYVE domain containing 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015214
Product type: DNA & cDNA
Ncbi symbol: WDFY3
Origin species: Human
Product name: WDFY3-WD repeat and FYVE domain containing 3 Gene
Size: 2ug
Accessions: BC015214
Gene id: 23001
Gene description: WD repeat and FYVE domain containing 3
Synonyms: ALFY; ZFYVE25; WD repeat and FYVE domain-containing protein 3; autophagy-linked FYVE protein; WD repeat and FYVE domain containing 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggcacctccaaagaaaaggccaagaccgtcaccctcaaacaggccttactgggccacactgataccgtcacctgcgccacagcatcattagcctatcacataattgtcagtgggtcccgtgatcgaacctgtatcatttgggatttgaacaaactgtcatttctaacccagcttcgagggcatcgagctccagtttctgctctttgtatcaatgaattaacaggggacattgtgtcctgcgctggcacatatatccatgtgtggagcatcaatgggaaccctatcgtgagtgtcaacacgttcacaggtaggagccagcagatcatctgctgctgcatgtcggagatgaacgaatgggacacgcagaacgtcatagtgacaggacactcagatggagtggttcggttttggagaatggaatttttgcaagttcctgaaacaccagctcctgagcctgctgaagtcctagaaatgcaggaagactgtccagaagcacaaatagggcaggaagcccaagacgaggacagcagtgattcagaagcagatgagcagagcatcagccaggaccctaaggacactccaagccaacccagcagcaccagccacaggccccgggcagcctcctgccgcgcaacagccgcctggtgtactgacagtggctctgacgactccagacgctggtccgaccagctcagtctagatgagaaagacggcttcatatttgtgaactattcagagggccagaccagagcccatctgcagggcccccttagccacccccaccccaatcccattgaggtgcggaattacagcagattgaaacctgggtaccgatgggaacggcagctggtgttcaggagtaagctgactatgcacacagcctttgatcgaaaggacaatgcacacccagctgaggtcactgccttgggcatctccaaggatcacagtaggatcctcgttggtgacagtcgaggccgagttttcagctggtctgtgagtgaccagccaggccgttctgctgctgatcactgggtgaaggatgaaggtggtgacagctgctcaggctgctcggtgaggttttcactcacagaaagacgacaccattgcaggaactgtggtcagctcttctgccagaagtgcagtcgctttcaatctgaaatcaaacgcttgaaaatctcatccccggtgcgtgtttgtcagaactgttattataacttacagcatgagagaggttcagaagatgggcctcgaaattgttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 18 open reading frame 25
- X-linked Kx blood group (McLeod syndrome)
- pancreatic lipase-related protein 2
- chromosome 9 open reading frame 102

Buy WDFY3-WD repeat and FYVE domain containing 3 Gene now

Add to cart