ACTG2-actin, gamma 2, smooth muscle, enteric Gene View larger

ACTG2-actin, gamma 2, smooth muscle, enteric Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ACTG2-actin, gamma 2, smooth muscle, enteric Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ACTG2-actin, gamma 2, smooth muscle, enteric Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012617
Product type: DNA & cDNA
Ncbi symbol: ACTG2
Origin species: Human
Product name: ACTG2-actin, gamma 2, smooth muscle, enteric Gene
Size: 2ug
Accessions: BC012617
Gene id: 72
Gene description: actin, gamma 2, smooth muscle, enteric
Synonyms: ACT; ACTA3; ACTE; ACTL3; ACTSG; VSCM; actin, gamma-enteric smooth muscle; actin-like protein; alpha-actin-3; actin, gamma 2, smooth muscle, enteric
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtgtgaagaggagaccaccgcgctcgtgtgtgacaatggctctggcctgtgcaaggcaggcttcgcaggagatgatgccccccgggctgtcttcccctccattgtgggccgccctcgccaccagggtgtgatggtgggaatgggccagaaagacagctatgtgggggatgaggctcagagcaagcgagggatcctaactctcaaataccccattgaacacggcatcatcaccaactgggatgacatggagaagatctggcaccactccttctacaatgagctgcgtgtagcacctgaagagcaccccaccctgctcacagaggctcccctaaatcccaaggccaacagggagaagatgacccagatcatgtttgaaaccttcaatgtccctgccatgtacgtcgccattcaagctgtgctctccctctatgcctctggccgcacgacaggcatcgtcctggattcaggtgatggcgtcacccacaatgtccccatctatgaaggctatgccctgccccatgccatcatgcgcctggacttggctggccgtgacctcacggactacctcatgaagatcctcacagagagaggctattcctttgtgaccacagctgagagagaaattgtgcgagacatcaaggagaagctgtgctatgtggccctggattttgagaatgagatggccacagcagcttcctcttcctccctggagaagagctatgagctgccagatgggcaggttatcaccattggcaatgagcgcttccgctgccctgagaccctcttccagccttcctttattggcatggagtccgctggaattcatgagacaacctacaattccatcatgaagtgtgacattgacatccgtaaggacttatatgccaacaatgtcctctctgggggcaccaccatgtaccctggcattgctgacaggatgcagaaggagatcacagccctggcccccagcaccatgaagatcaagattattgctcccccagagcggaagtactcagtctggatcgggggctctatcctggcctctctctccaccttccagcagatgtggatcagcaagcctgagtatgatgaggcagggccctccattgtccacaggaagtgcttctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ribonucleotide reductase M2 polypeptide
- solute carrier family 25, member 39
- WD repeat and FYVE domain containing 3
- chromosome 18 open reading frame 25

Buy ACTG2-actin, gamma 2, smooth muscle, enteric Gene now

Add to cart