C2orf65-chromosome 2 open reading frame 65 Gene View larger

C2orf65-chromosome 2 open reading frame 65 Gene

PTXBC014602

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C2orf65-chromosome 2 open reading frame 65 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C2orf65-chromosome 2 open reading frame 65 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014602
Product type: DNA & cDNA
Ncbi symbol: C2orf65
Origin species: Human
Product name: C2orf65-chromosome 2 open reading frame 65 Gene
Size: 2ug
Accessions: BC014602
Gene id: 130951
Gene description: chromosome 2 open reading frame 65
Synonyms: C2orf65; D6Mm5e; SPATA37; meiosis 1 arrest protein; meiosis 1 arresting protein; spermatogenesis associated 37; meiosis 1 associated protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcatcctgggcgaactactggtaaagggccctctactcacactcagattgaccagcaacctccacggcttctcattgtgcacattgctctaccgtcctgggctgacatctgcaccaacctctgtgaggctctgcagaacttcttctctctagcctgcagcttgatgggccccagccgcatgtccctgttcagtttatacatggtacaagatcagcatgagtgcatcctcccttttgtgcaagtgaaagggaactttgctaggttgcagacctgcatctcagaactccgcatgttacagagagaagggtgtttcagatcacaaggtgcttctctgcggctggcagtagaggatgggctccagcaattcaaacaatacagcagacatgtgaccacaagggcagctctgacctatacctccctggagattactattctgacttctcagcctggaaaagaggtggtcaaacagttggaggaagggttgaaagatacagacctagccagagtcaggaggtttcaggtcgttgaggtcacaaagggaatcctagagcacgtggactcagcgtctcctgttgaggataccagcaatgatgagagttctattctgggaactgacattgaccttcagactatagacaatgatatcgtcagcatggagattttcttcaaagcctggctacataacagtggaacagaccaagaacaaatccatcttcttctttcttcacagtgtttcagcaacatttccagacccagagataatccaatgtgtctgaaatgtgatctccaagagcgactgctctgcccatccctactcgctggcacagctgacggctccttgagaatggatgaccctaaaggagacttcatcacactctaccagatggcttcccagtcatcggcctctcattacaagctccaagtgatcaaggctttaaaatctagcgggctctgcgagtcattgacatatggactcccgttcatcctcagacctacaagctgttggcagctggactgggatgagctggagacaaatcagcaacatttccatgctttgtgtcacagcctgctggtgagtacccatgtccccaggtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - SH3-domain GRB2-like endophilin B2
- mitogen-activated protein kinase 14
- chromosome 3 open reading frame 37
- KDEL (Lys-Asp-Glu-Leu) containing 1

Buy C2orf65-chromosome 2 open reading frame 65 Gene now

Add to cart