Login to display prices
Login to display prices
C2orf65-chromosome 2 open reading frame 65 Gene View larger

C2orf65-chromosome 2 open reading frame 65 Gene

PTXBC014602

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C2orf65-chromosome 2 open reading frame 65 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C2orf65-chromosome 2 open reading frame 65 Gene

Proteogenix catalog: PTXBC014602
Ncbi symbol: C2orf65
Product name: C2orf65-chromosome 2 open reading frame 65 Gene
Size: 2ug
Accessions: BC014602
Gene id: 130951
Gene description: chromosome 2 open reading frame 65
Synonyms: C2orf65; D6Mm5e; SPATA37; meiosis 1 arrest protein; meiosis 1 arresting protein; spermatogenesis associated 37; meiosis 1 associated protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcatcctgggcgaactactggtaaagggccctctactcacactcagattgaccagcaacctccacggcttctcattgtgcacattgctctaccgtcctgggctgacatctgcaccaacctctgtgaggctctgcagaacttcttctctctagcctgcagcttgatgggccccagccgcatgtccctgttcagtttatacatggtacaagatcagcatgagtgcatcctcccttttgtgcaagtgaaagggaactttgctaggttgcagacctgcatctcagaactccgcatgttacagagagaagggtgtttcagatcacaaggtgcttctctgcggctggcagtagaggatgggctccagcaattcaaacaatacagcagacatgtgaccacaagggcagctctgacctatacctccctggagattactattctgacttctcagcctggaaaagaggtggtcaaacagttggaggaagggttgaaagatacagacctagccagagtcaggaggtttcaggtcgttgaggtcacaaagggaatcctagagcacgtggactcagcgtctcctgttgaggataccagcaatgatgagagttctattctgggaactgacattgaccttcagactatagacaatgatatcgtcagcatggagattttcttcaaagcctggctacataacagtggaacagaccaagaacaaatccatcttcttctttcttcacagtgtttcagcaacatttccagacccagagataatccaatgtgtctgaaatgtgatctccaagagcgactgctctgcccatccctactcgctggcacagctgacggctccttgagaatggatgaccctaaaggagacttcatcacactctaccagatggcttcccagtcatcggcctctcattacaagctccaagtgatcaaggctttaaaatctagcgggctctgcgagtcattgacatatggactcccgttcatcctcagacctacaagctgttggcagctggactgggatgagctggagacaaatcagcaacatttccatgctttgtgtcacagcctgctggtgagtacccatgtccccaggtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: