Login to display prices
Login to display prices
C3orf37-chromosome 3 open reading frame 37 Gene View larger

C3orf37-chromosome 3 open reading frame 37 Gene

PTXBC010125

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C3orf37-chromosome 3 open reading frame 37 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C3orf37-chromosome 3 open reading frame 37 Gene

Proteogenix catalog: PTXBC010125
Ncbi symbol: C3orf37
Product name: C3orf37-chromosome 3 open reading frame 37 Gene
Size: 2ug
Accessions: BC010125
Gene id: 56941
Gene description: chromosome 3 open reading frame 37
Synonyms: UPF0361 protein C3orf37; C3orf37; DC12; SRAPD1; embryonic stem cell-specific 5-hydroxymethylcytosine-binding protein; ES cell-specific 5hmC-binding protein; SRAP domain-containing protein 1; 5-hydroxymethylcytosine (hmC) binding, ES cell-specific
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtgtgggcgaacatcctgtcacttacctagagatgttctcacgagagcttgcgcctaccaggatcggcggggccagcagcggctcccggagtggagggaccctgataagtactgcccctcttacaacaagagtcctcaatccaacagcccagtgcttctgtctcgactgcactttgagaaggatgcagactcatctgagcgtatcattgctcccatgcgctggggcttggtcccttcttggttcaaagaaagtgatccttccaagctgcagttcaatactaccaactgtcgtagtgataccgtaatggagaaacggtcatttaaggtgcctctgggaaagggaagacgctgtgtcgttttagcagatggattctatgagtggcagcgatgtcagggaacaaaccagaggcagccatacttcatctattttcctcaaatcaagacagagaagtcaggtagcattggtgctgcagatagtcctgagaactgggagaaagtctgggacaactggaggctgctgacaatggccgggatctttgactgctgggagcccccagagggaggagatgtcctgtattcctataccatcatcacagtggattcctgcaaaggcttgagtgacatccaccacaggatgcctgccatattagatggagaggaggcagtttctaaatggcttgactttggtgaagtctcaactcaggaagctctgaaattaatccacccaacagagaacatcaccttccatgcagtctcttctgtggtgaacaactcgcgaaacaacactcctgagtgtctggctcctgtcgacttggtggtcaaaaaggagctcagggcaagtggcagtagccagaggatgttgcagtggttggccacaaagtcacccaaaaaggaagactcaaaaacacctcaaaaggaagagtcagatgttccccagtggtccagtcagttcctgcagaagagtccactccccaccaagagaggcactgcaggactcctagagcaatggctgaagcgggagaaggaggaggaacctgtggccaagcgtccttacagccagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: