Login to display prices
Login to display prices
SH3GLB2-SH3-domain GRB2-like endophilin B2 Gene View larger

SH3GLB2-SH3-domain GRB2-like endophilin B2 Gene

PTXBC014635

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SH3GLB2-SH3-domain GRB2-like endophilin B2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SH3GLB2-SH3-domain GRB2-like endophilin B2 Gene

Proteogenix catalog: PTXBC014635
Ncbi symbol: SH3GLB2
Product name: SH3GLB2-SH3-domain GRB2-like endophilin B2 Gene
Size: 2ug
Accessions: BC014635
Gene id: 56904
Gene description: SH3-domain GRB2-like endophilin B2
Synonyms: SH3-containing protein SH3GLB2; PP6569; PP9455; RRIG1; endophilin-B2; SH3 domain-containing GRB2-like protein B2; SH3-domain GRB2-like endophilin B2; retinoid receptor-induced gene 1; SH3 domain containing GRB2 like endophilin B2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggacttcaacatgaagaagctggcgtcggacgcgggcatcttcttcacccgggcggtgcagttcacggaggagaaatttggccaggctgagaagactgagcttgatgcccactttgaaaaccttctggcccgggcagacagcaccaagaactggacagagaagatcttgaggcagacagaggtgctgctgcagcccaaccccagtgcccgagtggaggagttcctgtatgagaagctggacaggaaggtcccctcaagggtcaccaacggggagctgctggctcagtacatggcagacgcggccagtgagctggggccgaccaccccctatgggaagacactgatcaaggtggcagaagctgaaaagcaactgggagccgcggagagggattttatccacacggcctccatcagcttcctcacacccttgcgcaacttcctggagggggactggaagaccatctcgaaggagaggcggctcctccaaaaccggcgtctggacttggatgcctgcaaagcgaggctgaagaaggccaaggctgcagaagccaaagccacgacggtgcctgactttcaggagactagacctcgtaattacattctctcggccagcgcctccgcgctctggaatgatgaagtggacaaggccgagcaggagctccgcgtggcccagacagagtttgaccggcaagcagaagtgacccgtctcttgctggagggaatcagtagcactcacgtgaaccacctgcgctgcctccacgagttcgtcaagtctcagacaacctactacgcacagtgctaccgccacatgctggacttgcagaagcagctgggcagatttcccggcaccttcgtgggcaccacagagcccgcctccccacccctgagcagcacctcacccaccactgctgcggccactatgcctgtggtgccctctgtggccagcctggcccctccaggggaggcctcgctctgcctggaagaggtggccccccctgccagtgggacccgcaaagctcgggtgctctatgactacgaggcagccgacagcagtgagctggccctgctggctgatgagctcatcactgtctacagcctgcctggcatggaccctgactggctcattggcgagagaggcaacaagaagggcaaggtccctgtcacctacttggaactgctcagctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: