Cart 6 Product Products 704,70 € (empty)
-
1 x ACTB-actin...121,50 € -
1 x RPLP2-ribo...113,40 € -
1 x PCGF5-poly...113,40 € -
1 x ZDHHC3-zin...121,50 € -
1 x PDGFRL-pla...121,50 € -
1 x C2orf76-ch...113,40 €
No products
To be determined Shipping
704,70 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 6 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 704,70 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 704,70 €
Data sheet of MAPK14-mitogen-activated protein kinase 14 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MAPK14-mitogen-activated protein kinase 14 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000092 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MAPK14 |
| Origin species: | Human |
| Product name: | MAPK14-mitogen-activated protein kinase 14 Gene |
| Size: | 2ug |
| Accessions: | BC000092 |
| Gene id: | 1432 |
| Gene description: | mitogen-activated protein kinase 14 |
| Synonyms: | CSBP; CSBP1; CSBP2; CSPB1; EXIP; Mxi2; PRKM14; PRKM15; SAPK2A; p38ALPHA; mitogen-activated protein kinase 14; CSAID-binding protein; Csaids binding protein; MAP kinase 14; MAP kinase Mxi2; MAP kinase p38 alpha; MAX-interacting protein 2; cytokine suppressive anti-inflammatory drug binding protein; mitogen-activated protein kinase p38 alpha; p38 MAP kinase; p38 mitogen activated protein kinase; p38alpha Exip; stress-activated protein kinase 2A |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtctcaggagaggcccacgttctaccggcaggagctgaacaagacaatctgggaggtgcccgagcgttaccagaacctgtctccagtgggctctggcgcctatggctctgtgtgtgctgcttttgacacaaaaacggggttacgtgtggcagtgaagaagctctccagaccatttcagtccatcattcatgcgaaaagaacctacagagaactgcggttacttaaacatatgaaacatgaaaatgtgattggtctgttggacgtttttacacctgcaaggtctctggaggaattcaatgatgtgtatctggtgacccatctcatgggggcagatctgaacaacattgtgaaatgtcagaagcttacagatgaccatgttcagttccttatctaccaaattctccgaggtctaaagtatatacattcagctgacataattcacagggacctaaaacctagtaatctagctgtgaatgaagactgtgagctgaagattctggattttggactggctcggcacacagatgatgaaatgacaggctacgtggccactaggtggtacagggctcctgagatcatgctgaactggatgcattacaaccagacagttgatatttggtcagtgggatgcataatggccgagctgttgactggaagaacattgtttcctggtacagaccatattgatcagttgaagctcattttaagactcgttggaaccccaggggctgagcttttgaagaaaatctcctcagagtctgcaagaaactatattcagtctttgactcagatgccgaagatgaactttgcgaatgtatttattggtgccaatcccctggctgtcgacttgctggagaagatgcttgtattggactcagataagagaattacagcggcccaagcccttgcacatgcctactttgctcagtaccacgatcctgatgatgaaccagtggccgatccttatgatcagtcctttgaaagcagggacctccttatagatgagtggaaaagcctgacctatgatgaagtcatcagctttgtgccaccaccccttgaccaagaagagatggagtcctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chromosome 3 open reading frame 37 - KDEL (Lys-Asp-Glu-Leu) containing 1 - solute carrier family 44, member 5 - chromosome 3 open reading frame 46 |