MAPK14-mitogen-activated protein kinase 14 Gene View larger

MAPK14-mitogen-activated protein kinase 14 Gene

PTXBC000092

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MAPK14-mitogen-activated protein kinase 14 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MAPK14-mitogen-activated protein kinase 14 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000092
Product type: DNA & cDNA
Ncbi symbol: MAPK14
Origin species: Human
Product name: MAPK14-mitogen-activated protein kinase 14 Gene
Size: 2ug
Accessions: BC000092
Gene id: 1432
Gene description: mitogen-activated protein kinase 14
Synonyms: CSBP; CSBP1; CSBP2; CSPB1; EXIP; Mxi2; PRKM14; PRKM15; SAPK2A; p38ALPHA; mitogen-activated protein kinase 14; CSAID-binding protein; Csaids binding protein; MAP kinase 14; MAP kinase Mxi2; MAP kinase p38 alpha; MAX-interacting protein 2; cytokine suppressive anti-inflammatory drug binding protein; mitogen-activated protein kinase p38 alpha; p38 MAP kinase; p38 mitogen activated protein kinase; p38alpha Exip; stress-activated protein kinase 2A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtctcaggagaggcccacgttctaccggcaggagctgaacaagacaatctgggaggtgcccgagcgttaccagaacctgtctccagtgggctctggcgcctatggctctgtgtgtgctgcttttgacacaaaaacggggttacgtgtggcagtgaagaagctctccagaccatttcagtccatcattcatgcgaaaagaacctacagagaactgcggttacttaaacatatgaaacatgaaaatgtgattggtctgttggacgtttttacacctgcaaggtctctggaggaattcaatgatgtgtatctggtgacccatctcatgggggcagatctgaacaacattgtgaaatgtcagaagcttacagatgaccatgttcagttccttatctaccaaattctccgaggtctaaagtatatacattcagctgacataattcacagggacctaaaacctagtaatctagctgtgaatgaagactgtgagctgaagattctggattttggactggctcggcacacagatgatgaaatgacaggctacgtggccactaggtggtacagggctcctgagatcatgctgaactggatgcattacaaccagacagttgatatttggtcagtgggatgcataatggccgagctgttgactggaagaacattgtttcctggtacagaccatattgatcagttgaagctcattttaagactcgttggaaccccaggggctgagcttttgaagaaaatctcctcagagtctgcaagaaactatattcagtctttgactcagatgccgaagatgaactttgcgaatgtatttattggtgccaatcccctggctgtcgacttgctggagaagatgcttgtattggactcagataagagaattacagcggcccaagcccttgcacatgcctactttgctcagtaccacgatcctgatgatgaaccagtggccgatccttatgatcagtcctttgaaagcagggacctccttatagatgagtggaaaagcctgacctatgatgaagtcatcagctttgtgccaccaccccttgaccaagaagagatggagtcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 3 open reading frame 37
- KDEL (Lys-Asp-Glu-Leu) containing 1
- solute carrier family 44, member 5
- chromosome 3 open reading frame 46

Buy MAPK14-mitogen-activated protein kinase 14 Gene now

Add to cart