Cart 1 Product Products 113,40 € (empty)
-
1 x S100A8-S10...113,40 €
No products
To be determined Shipping
113,40 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 113,40 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 113,40 €
View larger 
UQCRFS1-ubiquinol-cytochrome c reductase, Rieske iron-sulfur polypeptide 1 Gene
PTXBC000649
New product
Data sheet of UQCRFS1-ubiquinol-cytochrome c reductase, Rieske iron-sulfur polypeptide 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about UQCRFS1-ubiquinol-cytochrome c reductase, Rieske iron-sulfur polypeptide 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000649 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | UQCRFS1 |
| Origin species: | Human |
| Product name: | UQCRFS1-ubiquinol-cytochrome c reductase, Rieske iron-sulfur polypeptide 1 Gene |
| Size: | 2ug |
| Accessions: | BC000649 |
| Gene id: | 7386 |
| Gene description: | ubiquinol-cytochrome c reductase, Rieske iron-sulfur polypeptide 1 |
| Synonyms: | RIP1; RIS1; RISP; UQCR5; cytochrome b-c1 complex subunit Rieske, mitochondrial; Rieske iron-sulfur protein; complex III subunit 5; cytochrome b-c1 complex subunit 5; ubiquinol-cytochrome c reductase iron-sulfur subunit; ubiquinol-cytochrome c reductase, Rieske iron-sulfur polypeptide 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgttgtcggtagcagcccgctcgggcccgttcgcgcccgtcctgtcggccacgtcccgcggggtggcgggcgcgctgcggcccttggtgcaggccacggtgcccgccaccccggagcagcctgtgttggacctgaagcggcccttcctcagccgggagtcgctgagcggccaggccgtgcgccggcctttggtcgcctccgtgggcctcaatgtccctgcttctgtttgttattcccacacagacatcaaggtgcctgacttctctgaataccgccgccttgaagttttagatagtacgaagtcttcaagagaaagcagcgaggctaggaaaggtttctcctatttggtaactggagtaactactgtgggtgtcgcatatgctgccaagaatgccgtcacccagttcgtttccagcatgagtgcttctgctgatgtgttggccctggcgaaaatcgaaatcaagttatctgatattccagaaggcaagaacatggctttcaaatggagaggcaaacccctgtttgtgcgtcatagaacccagaaggaaattgagcaggaagctgcagttgaattatcacagttgagggacccacagcatgatctagatcgagtaaagaaacctgaatgggttatcctgataggtgtttgcactcatcttggctgtgtacccattgcaaatgcaggagattttggtggttattactgcccttgccatgggtcacactatgatgcatctggcaggatcagattgggtcctgctcctctcaaccttgaagtccccacgtatgagttcaccagtgacgatatggtgattgttggttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - nuclear factor of kappa light polypeptide gene enhancer in B-cells 1 - protein phosphatase 2 (formerly 2A), regulatory subunit B'', gamma - solute carrier family 4, sodium bicarbonate cotransporter, member 4 - golgi associated, gamma adaptin ear containing, ARF binding protein 1 |