Cart 1 Product Products 113,40 € (empty)
-
1 x PRDX3-pero...113,40 €
No products
To be determined Shipping
113,40 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 113,40 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 113,40 €
View larger 
PSTPIP2-proline-serine-threonine phosphatase interacting protein 2 Gene
PTXBC035395
New product
Data sheet of PSTPIP2-proline-serine-threonine phosphatase interacting protein 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PSTPIP2-proline-serine-threonine phosphatase interacting protein 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC035395 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PSTPIP2 |
| Origin species: | Human |
| Product name: | PSTPIP2-proline-serine-threonine phosphatase interacting protein 2 Gene |
| Size: | 2ug |
| Accessions: | BC035395 |
| Gene id: | 9050 |
| Gene description: | proline-serine-threonine phosphatase interacting protein 2 |
| Synonyms: | proline-serine-threonine phosphatase-interacting protein 2; PEST phosphatase-interacting protein 2; proline-serine-threonine phosphatase interacting protein 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgacgcgctcactgttcaagggaaacttttggagtgcagacatcctcagcaccatcggctatgacaacattatccaacatctgaacaatggccgcaagaactgcaaagagtttgaagactttctaaaagaaagggcagcaattgaagagaggtatggcaaagatctgctcaacctctctaggaagaagccgtgtggacagtctgaaatcaacaccctgaagcgggcccttgaagtcttcaagcagcaagtagacaatgtggcacaatgtcacattcagcttgcacagagtttaagagaagaggccaggaagatggaagaattcagggaaaagcaaaaactacaacgaaaaaagacagagctcataatggatgctatccataaacaaaagagcttacaattcaagaaaaccatggatgcaaagaagaactatgagcagaaatgccgggacaaagatgaggcagaacaggccgtcagccggagtgccaacctggtgaacccgaagcaacaagaaaagctttttgtgaaactggcaacttcaaagaccgcagtagaggactcagacaaagcatacatgctgcacatcggcaccctggataaggtccgagaagagtggcagagtgagcacatcaaggcctgcgaggcatttgaggctcaagaatgtgaacgaataaacttcttccggaatgcattgtggttacatgtgaatcagctgtcacaacaatgtgtcaccagtgatgaacacccatcatgtatgagaatttctactcctcccagaagaatgcagtcccagcaggaaaggctacagggcctaacttggcaaggagaggacccctcccaattcctaaaagctcaccagatgatcccaattactctttggttgatgactacagtttgctctatcagtaaaatcaatgaaaccagagctttttccggctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - serpin peptidase inhibitor, clade B (ovalbumin), member 1 - synovial sarcoma translocation gene on chromosome 18-like 1 - protein phosphatase 1, regulatory (inhibitor) subunit 12C - guanine nucleotide binding protein (G protein), q polypeptide |