SERPINB1-serpin peptidase inhibitor, clade B (ovalbumin), member 1 Gene View larger

SERPINB1-serpin peptidase inhibitor, clade B (ovalbumin), member 1 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SERPINB1-serpin peptidase inhibitor, clade B (ovalbumin), member 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SERPINB1-serpin peptidase inhibitor, clade B (ovalbumin), member 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009015
Product type: DNA & cDNA
Ncbi symbol: SERPINB1
Origin species: Human
Product name: SERPINB1-serpin peptidase inhibitor, clade B (ovalbumin), member 1 Gene
Size: 2ug
Accessions: BC009015
Gene id: 1992
Gene description: serpin peptidase inhibitor, clade B (ovalbumin), member 1
Synonyms: ELANH2; HEL-S-27; HEL57; LEI; M/NEI; MNEI; PI-2; PI2; leukocyte elastase inhibitor; epididymis luminal protein 57; epididymis secretory protein Li 27; peptidase inhibitor 2; protease inhibitor 2 (anti-elastase), monocyte/neutrophil derived; serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 1; serpin peptidase inhibitor, clade B (ovalbumin), member 1; serpin family B member 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagcagctgagctcagcaaacacccgcttcgccttggacctgttcctggcgttgagtgagaacaatccggctggaaacatcttcatctctcccttcagcatttcatctgctatggccatggtttttctggggaccagaggtaacacggcagcacagctgtccaagactttccatttcaacacggttgaagaggttcattcaagattccagagtctgaatgctgatatcaacaaacgtggagcgtcttatattctgaaacttgctaatagattatatggagagaaaacttacaatttccttcctgagttcttggtttcgactcagaaaacatatggtgctgacctggccagtgtggattttcagcatgcctctgaagatgcaaggaagaccataaaccagtgggtcaaaggacagacagaaggaaaaattccggaactgttggcttcgggcatggttgataacatgaccaaacttgtgctagtaaatgccatctatttcaagggaaactggaaggataaattcatgaaagaagccacgacgaatgcaccattcagattgaataagaaagacagaaaaactgtgaaaatgatgtatcagaagaaaaaatttgcatatggctacatcgaggaccttaagtgccgtgtgctggaactgccttaccaaggcgaggagctcagcatggtcatcctgctgccggatgacattgaggacgagtccacgggcctgaagaagattgaggaacagttgactttggaaaagttgcatgagtggactaaacctgagaatctcgatttcattgaagttaatgtcagcttgcccaggttcaaactggaagagagttacactctcaactccgacctcgcccgcctaggtgtgcaggatctctttaacagtagcaaggctgatctgtctggcatgtcaggagccagagatatttttatatcaaaaattgtccacaagtcatttgtggaagtgaatgaagagggaacagaggcggcagctgccacagcaggcatcgcaactttctgcatgttgatgcccgaagaaaatttcactgccgaccatccattccttttctttattcggcataattcctcaggtagcatcctattcttggggagattttcttccccttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - synovial sarcoma translocation gene on chromosome 18-like 1
- protein phosphatase 1, regulatory (inhibitor) subunit 12C
- guanine nucleotide binding protein (G protein), q polypeptide
- XK, Kell blood group complex subunit-related family, member 3

Buy SERPINB1-serpin peptidase inhibitor, clade B (ovalbumin), member 1 Gene now

Add to cart