Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
GNAQ-guanine nucleotide binding protein (G protein), q polypeptide Gene
PTXBC057777
New product
Data sheet of GNAQ-guanine nucleotide binding protein (G protein), q polypeptide Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GNAQ-guanine nucleotide binding protein (G protein), q polypeptide Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC057777 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GNAQ |
| Origin species: | Human |
| Product name: | GNAQ-guanine nucleotide binding protein (G protein), q polypeptide Gene |
| Size: | 2ug |
| Accessions: | BC057777 |
| Gene id: | 2776 |
| Gene description: | guanine nucleotide binding protein (G protein), q polypeptide |
| Synonyms: | CMC1; G-ALPHA-q; GAQ; SWS; guanine nucleotide-binding protein G(q) subunit alpha; guanine nucleotide binding protein (G protein), q polypeptide; guanine nucleotide-binding protein alpha-q; G protein subunit alpha q |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgactctggagtccatcatggcgtgctgcctgagcgaggaggccaaggaagcccggcggatcaacgacgagatcgagcggcagctccgcagggacaagcgggacgcccgccgggagctcaagctgctgctgctcgggacaggagagagtggcaagagtacgtttatcaagcagatgagaatcatccatgggtcaggatactctgatgaagataaaaggggcttcaccaagctggtgtatcagaacatcttcacggccatgcaggccatgatcagagccatggacacactcaagatcccatacaagtatgagcacaataaggctcatgcacaattagttcgagaagttgatgtggagaaggtgtctgcttttgagaatccatatgtagatgcaataaagagtttatggaatgatcctggaatccaggaatgctatgatagacgacgagaatatcaattatctgactctaccaaatactatcttaatgacttggaccgcgtagctgaccctgcctacctgcctacgcaacaagatgtgcttagagttcgagtccccaccacagggatcatcgaatacccctttgacttacaaagtgtcattttcagaatggtcgatgtagggggccaaaggtcagagagaagaaaatggatacactgctttgaaaatgtcacctctatcatgtttctagtagcgcttagtgaatatgatcaagttctcgtggagtcagacaatgagaaccgaatggaggaaagcaaggctctctttagaacaattatcacatacccctggttccagaactcctcggttattctgttcttaaacaagaaagatcttctagaggagaaaatcatgtattcccatctagtcgactacttcccagaatatgatggaccccagagagatgcccaggcagcccgagaattcattctgaagatgttcgtggacctgaacccagacagtgacaaaattatctactcccacttcacgtgcgccacagacaccgagaatatccgctttgtctttgctgccgtcaaggacaccatcctccagttgaacctgaaggagtacaatctggtctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - XK, Kell blood group complex subunit-related family, member 3 - chondroitin sulfate N-acetylgalactosaminyltransferase 1 - CWC15 spliceosome-associated protein homolog (S. cerevisiae) - NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 3, 9kDa |