Login to display prices
Login to display prices
SS18L1-synovial sarcoma translocation gene on chromosome 18-like 1 Gene View larger

SS18L1-synovial sarcoma translocation gene on chromosome 18-like 1 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SS18L1-synovial sarcoma translocation gene on chromosome 18-like 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SS18L1-synovial sarcoma translocation gene on chromosome 18-like 1 Gene

Proteogenix catalog: PTXBC034494
Ncbi symbol: SS18L1
Product name: SS18L1-synovial sarcoma translocation gene on chromosome 18-like 1 Gene
Size: 2ug
Accessions: BC034494
Gene id: 26039
Gene description: synovial sarcoma translocation gene on chromosome 18-like 1
Synonyms: SS18L1, nBAF chromatin remodeling complex subunit; CREST; LP2261; calcium-responsive transactivator; SS18-like protein 1; SYT homolog 1; synovial sarcoma translocation gene on chromosome 18-like 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtccgtggccttcgcgtctgcccggccaagaggcaaaggggaggttacgcagcaaaccatccagaagatgctggacgagaaccaccacctgatccagtgcatcctggagtaccagagcaagggcaagacggccgagtgcacgcagtaccagcagatcctgcaccggaacctggtatacctggccacgatcgcagactccaaccagaacatgcagtccctgcttcctgccccgcccacgcagaacatgaacctgggccctggagccctgactcagagcggctccagccagggcctgcactctcagggcagcctgagtgacgccatcagcacgggcctgccaccctcctccctcctgcagggccagattggcaacgggccgagccacgtgtccatgcagcagacggcgcctaacacgctgcccaccacctccatgagcatctctgggcccggctacagccacgcgggacccgcctcgcagggcgtccccatgcaggggcaaggcaccatcggcaactacgtgtctcggaccaacatcaacatgcagtccaacccagtctccatgatacagcagcaggcggccacgtcgcactacagctcggcgcagggcggcagccagcactaccagggccagtcgtccatcgccatgatggggcagggcagccaggggagcagcatgatggggcagcggcccatggcgccctaccggccctcccagcaaggctcttcccagcagtacctgggccaggaggagtactatggcgagcagtacagccacagccagggcgccgcggagcccatgggccagcagtactaccccgacggccatggcgattacgcctaccagcagtcatcctacacggagcagagctacgaccggtccttcgaggagtccacgcagcactactatgaggggggaaactcccagtacagccagcagcaggccgggtaccagcagggtgccgcgcagcagcagacgtactcccagcagcagtaccccagccagcagagctaccccgggcagcagcagggctacgggtctgcccagggagccccgtcacagtaccccggctaccagcaaggccaaggccagcagtacggaagctaccgagcaccgcagacagcgccgtctgcccagcagcagcggccctacggctatgaacagggccagtatggaaattaccagcagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: