Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of EPDR1-ependymin related protein 1 (zebrafish) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about EPDR1-ependymin related protein 1 (zebrafish) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC018299 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | EPDR1 |
| Origin species: | Human |
| Product name: | EPDR1-ependymin related protein 1 (zebrafish) Gene |
| Size: | 2ug |
| Accessions: | BC018299 |
| Gene id: | 54749 |
| Gene description: | ependymin related protein 1 (zebrafish) |
| Synonyms: | EPDR; MERP-1; MERP1; UCC1; mammalian ependymin-related protein 1; ependymin related protein 1; mammalian ependymin related protein 1; upregulated in colorectal cancer gene 1 protein; ependymin related 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgccaggacgcgctcccctccgcaccgtcccgggcgccctgggtgcctggctgctgggcggcctctgggcctggaccctgtgcggcctgtgcagcctgggggcggtgggagccccgcgcccgtgccaggcgccgcagcagtgggaggggcgccaggttatgtaccagcaaagtagcgggcgcaacagccgcgccctgctctcctacgacgggctcaaccagcgcgtgcgggtgctggacgagaggaaggcgctgatcccctgcaagagattatttgaatatattttgctgtataaggatggagtgatgtttcagattgaccaagccaccaagcagtgctcaaagatgaccctgacacagccctgggatcctcttgacattcctcaaaactccacctttgaagaccagtactccattggggggcctcaggagcagatcaccgtccaggagtggtcggacagaaagtcagctagatcctatgaaacctggattggcatctatacagtcaaggattgctatcctgtccaggaaacctttaccataaactacagtgtgatattgtctacgcggttttttgacatccagctgggtattaaagacccctcggtgtttacccctccaagcacgtgccagatggcccaactggagaagatgagcgaagactgctcctggtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - HRAS-like suppressor family, member 5 - D4, zinc and double PHD fingers family 2 - lysosomal-associated membrane protein 1 - isocitrate dehydrogenase 3 (NAD+) gamma |