Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
MYL6B-myosin, light chain 6B, alkali, smooth muscle and non-muscle Gene
PTXBC014400
New product
Data sheet of MYL6B-myosin, light chain 6B, alkali, smooth muscle and non-muscle Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MYL6B-myosin, light chain 6B, alkali, smooth muscle and non-muscle Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC014400 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MYL6B |
| Origin species: | Human |
| Product name: | MYL6B-myosin, light chain 6B, alkali, smooth muscle and non-muscle Gene |
| Size: | 2ug |
| Accessions: | BC014400 |
| Gene id: | 140465 |
| Gene description: | myosin, light chain 6B, alkali, smooth muscle and non-muscle |
| Synonyms: | MLC1SA; myosin light chain 6B; myosin alkali light chain 1 slow a; myosin light chain 1 slow a; myosin light chain 1, slow-twitch muscle A isoform; myosin, light chain 6B, alkali, smooth muscle and non-muscle; myosin, light polypeptide 6B, alkali, smooth muscle and non-muscle; smooth muscle and non-muscle myosin alkali light chain 6B; smooth muscle and nonmuscle myosin light chain alkali 6B |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcctcccaagaaggatgttcccgtgaagaaaccagcagggccctccatctccaaacctgctgctaagccagcagcagcaggggctcctccagccaagaccaaagctgagccagctgtcccccaggcccctcagaaaacccaggagcctccagtcgatctctccaaagtggtgatcgagtttaacaaggaccagctggaggagttcaaggaggccttcgagctgtttgaccgagtgggggatggcaagatcctgtacagccagtgtggggacgtgatgagggccctgggccagaaccccaccaacgccgaggtgctcaaggtcctggggaaccccaagagtgatgagctgaagtcgcggcgtgtggactttgagactttcctgcccatgctccaggcagtggccaagaaccgaggccaaggcacatatgaggactacttggaggggtttcgtgtgtttgacaaggaggggaacggcaaagtcatgggagcagagctcagacatgttctcaccacccttggagagaagatgactgaggaggaggtggagaccgttctggcaggacacgaggacagcaacggctgcatcaactacgaggccttcttgaaacacatcctaagcgtctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - proline-serine-threonine phosphatase interacting protein 2 - serpin peptidase inhibitor, clade B (ovalbumin), member 1 - synovial sarcoma translocation gene on chromosome 18-like 1 - protein phosphatase 1, regulatory (inhibitor) subunit 12C |