Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of REG4-regenerating islet-derived family, member 4 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about REG4-regenerating islet-derived family, member 4 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC017089 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | REG4 |
| Origin species: | Human |
| Product name: | REG4-regenerating islet-derived family, member 4 Gene |
| Size: | 2ug |
| Accessions: | BC017089 |
| Gene id: | 83998 |
| Gene description: | regenerating islet-derived family, member 4 |
| Synonyms: | GISP; REG-IV; RELP; regenerating islet-derived protein 4; REG-4; REG-like protein; gastrointestinal secretory protein; reg IV; regenerating gene type IV; regenerating islet-derived family, member 4; regenerating islet-derived protein IV; regenerating family member 4 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcttccagaagcatgcggctgctcctattgctgagctgcctggccaaaacaggagtcctgggtgatatcatcatgagacccagctgtgctcctggatggttttaccacaagtccaattgctatggttacttcaggaagctgaggaactggtctgatgccgagctcgagtgtcagtcttacggaaacggagcccacctggcatctatcctgagtttaaaggaagccagcaccatagcagagtacataagtggctatcagagaagccagccgatatggattggcctgcacgacccacagaagaggcagcagtggcagtggattgatggggccatgtatctgtacagatcctggtctggcaagtccatgggtgggaacaagcactgtgctgagatgagctccaataacaactttttaacttggagcagcaacgaatgcaacaagcgccaacacttcctgtgcaagtaccgaccatag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - casein kinase 2, alpha prime polypeptide - farnesyl-diphosphate farnesyltransferase 1 - potassium channel, subfamily K, member 13 - keratin 23 (histone deacetylase inducible) |