CSNK2A2-casein kinase 2, alpha prime polypeptide Gene View larger

CSNK2A2-casein kinase 2, alpha prime polypeptide Gene

PTXBC008812

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CSNK2A2-casein kinase 2, alpha prime polypeptide Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CSNK2A2-casein kinase 2, alpha prime polypeptide Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008812
Product type: DNA & cDNA
Ncbi symbol: CSNK2A2
Origin species: Human
Product name: CSNK2A2-casein kinase 2, alpha prime polypeptide Gene
Size: 2ug
Accessions: BC008812
Gene id: 1459
Gene description: casein kinase 2, alpha prime polypeptide
Synonyms: CK2A2; CK2alpha'; CSNK2A1; casein kinase II subunit alpha'; CK II alpha'; casein kinase 2 alpha'; casein kinase 2, alpha prime polypeptide; casein kinase 2 alpha 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcccggcccggccgcgggcagcagggcccgggtctacgccgaggtgaacagtctgaggagccgcgagtactgggactacgaggctcacgtcccgagctggggtaatcaagatgattaccaactggttcgaaaacttggtcggggaaaatatagtgaagtatttgaggccattaatatcaccaacaatgagagagtggttgtaaaaatcctgaagccagtgaagaaaaagaagataaaacgagaggttaagattctggagaaccttcgtggtggaacaaatatcattaagctgattgacactgtaaaggaccccgtgtcaaagacaccagctttggtatttgaatatatcaataatacagattttaagcaactctaccagatcctgacagactttgatatccggttttatatgtatgaactacttaaagctctggattactgccacagcaagggaatcatgcacagggatgtgaaacctcacaatgtcatgatagatcaccaacagaaaaagctgcgactgatagattggggtctggcagaattctatcatcctgctcaggagtacaatgttcgtgtagcctcaaggtacttcaagggaccagagctcctcgtggactatcagatgtatgattatagcttggacatgtggagtttgggctgtatgttagcaagcatgatctttcgaagggaaccattcttccatggacaggacaactatgaccagcttgttcgcattgccaaggttctgggtacagaagaactgtatgggtatctgaagaagtatcacatagacctagatccacacttcaacgatatcctgggacaacattcacggaaacgctgggaaaactttatccatagtgagaacagacaccttgtcagccctgaggccctagatcttctggacaaacttctgcgatacgaccatcaacagagactgactgccaaagaggccatggagcacccatacttctaccctgtggtgaaggagcagtcccagccttgtgcagacaatgctgtgctttccagtggtctcacggcagcacgatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - farnesyl-diphosphate farnesyltransferase 1
- potassium channel, subfamily K, member 13
- keratin 23 (histone deacetylase inducible)
- asparagine synthetase domain containing 1

Buy CSNK2A2-casein kinase 2, alpha prime polypeptide Gene now

Add to cart