KCNK13-potassium channel, subfamily K, member 13 Gene View larger

KCNK13-potassium channel, subfamily K, member 13 Gene

PTXBC012779

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of KCNK13-potassium channel, subfamily K, member 13 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about KCNK13-potassium channel, subfamily K, member 13 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012779
Product type: DNA & cDNA
Ncbi symbol: KCNK13
Origin species: Human
Product name: KCNK13-potassium channel, subfamily K, member 13 Gene
Size: 2ug
Accessions: BC012779
Gene id: 56659
Gene description: potassium channel, subfamily K, member 13
Synonyms: K2p13.1; THIK-1; THIK1; potassium channel subfamily K member 13; K2P13.1 potassium channel; potassium channel, subfamily K, member 13; potassium channel, two pore domain subfamily K, member 13; tandem pore domain halothane-inhibited potassium channel 1; tandem pore domain potassium channel THIK-1; potassium two pore domain channel subfamily K member 13
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctggccggggtttcagctggggcccgggccacctgaacgaggacaacgcgcgctttctgctgctggccgcgctcatcgtgctctacctgctgggcggcgccgccgtcttctccgcgctggagctggcgcacgagcgccaggccaagcagcgctgggaggagcgcctggccaacttcagccgcggccacaacctgagccgcgacgagctgcgcggcttcctccgccactacgaggaggccactcgggccggcatccgcgtggacaacgtccgcccgcgctgggacttcaccggcgccttctacttcgtgggcaccgtcgtttccaccatagggtttgggatgacaactccggcgacagtaggaggaaaaatctttctgatcttttacggccttgttgggtgttccagcaccatcttgttcttcaacctcttcctggagcgcctgatcaccatcatcgcctacatcatgaagtcgtgccaccagcggcagctccggagacgaggggccctgccccaggagagcctgaaggatgcggggcagtgtgaggtggacagcctggccggctggaagccctccgtgtactacgtcatgctgatcctatgcacagcctccatcctcatctcttgctgcgcctcagccatgtacacccccattgaaggctggagctactttgactcactctacttctgttttgtggctttcagcaccattggctttggggacctggtcagcagccagaacgcccactatgagagccaaggcctctatcgctttgccaacttcgtcttcatcctcatgggtgtctgctgcatctactccttgttcaatgtcatctctatcctcatcaaacagtccttgaactggatcctgaggaaaatggacagcgggtgctgcccgcaatgccagagaggactcttgcgatcacgcaggaacgtggtgatgccaggcagcgtccggaaccgctgcaacatctccatagagacagacggggtggcagagagtgacacggacgggcgccggctctcaggggagatgatctccatgaaggacttgctggcagccaacaaggcctcgttggccatcctgcagaagcaactgtctgagatggccaacggctgcccccaccagaccagcacactggcccgggacaatgaattctcagggggggtgggagcctttgcaatcatgaacaacaggttggcagagaccagtggggacaggtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - keratin 23 (histone deacetylase inducible)
- asparagine synthetase domain containing 1
- amyloid beta (A4) precursor-like protein 1
- TOX high mobility group box family member 4

Buy KCNK13-potassium channel, subfamily K, member 13 Gene now

Add to cart