KRT23-keratin 23 (histone deacetylase inducible) Gene View larger

KRT23-keratin 23 (histone deacetylase inducible) Gene

PTXBC028356

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of KRT23-keratin 23 (histone deacetylase inducible) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about KRT23-keratin 23 (histone deacetylase inducible) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC028356
Product type: DNA & cDNA
Ncbi symbol: KRT23
Origin species: Human
Product name: KRT23-keratin 23 (histone deacetylase inducible) Gene
Size: 2ug
Accessions: BC028356
Gene id: 25984
Gene description: keratin 23 (histone deacetylase inducible)
Synonyms: CK23; HAIK1; K23; keratin, type I cytoskeletal 23; CK-23; cytokeratin 23; histone deacetylase inducible keratin 23; hyperacetylation-inducible type I keratin; keratin 23 (histone deacetylase inducible); keratin 23, type I; type I intermediate filament cytokeratin; keratin 23
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaactccggacacagcttcagccagaccccctcggcctccttccatggcgccggaggtggctggggccggcccaggagcttccccagggctcccaccgtccatggcggtgcggggggagcccgcatctccctgtccttcaccacgcggagctgcccaccccctggagggtcttggggttctggaagaagcagccccctactaggcggaaatgggaaggccaccatgcagaatctcaacgaccgcctggcctcctacgtggagaaggttcgcgccctggaggaggccaacatgaagctggaaagccgcatcctgaaatggcaccagcagagagatcctggcagtaagaaagattattcacagtatgaggaaaacatcacacacctgcaggagcagatagtggatggtaagatgaccaatgctcagattattcttctcattgacaatgccaggatggcagtggatgacttcaacctcaagtatgaaaatgaacactcctttaagaaagacttggaaattgaagtcgagggcctccgaaggaccttagacaacctgaccattgtcacaacagacctagaacaggaggtggaaggaatgaggaaagagctcattctcatgaagaagcaccatgagcaggaaatggagaagcatcatgtgccaagtgacttcaatgtcaatgtgaaggtggatacgggtcccagggaagatctgattaaggtcctggaggatatgagacaagaatatgagcttataataaagaagaagcatcgagacttggacacttggtataaagaacagtctgcagccatgtcccaggaggcagccagtccagccactgtgcagagcagacaaggtgacatccacgaactgaagcgcacattccaggccctggagattgacctgcagacacagtacagcacgaaatctgctttggaaaacatgttatccgagacccagtctcggtactcctgcaagctccaggacatgcaagagatcatctcccactatgaggaggaactgacgcagctacgccatgaactggagcggcagaacaatgaataccaagtgctgctgggcatcaaaacccacctggagaaggaaatcaccacgtaccgacggctcctggagggagagagtgaagggacacgggaagaatcaaagtcgagcatgaaagtgtttgcaactccaaagatcaaggccataacccaggagaccatcaacggaagattagttctttgtcaagtgaatgaaatccaaaagcacgcatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - asparagine synthetase domain containing 1
- amyloid beta (A4) precursor-like protein 1
- TOX high mobility group box family member 4
- C-type lectin domain family 10, member A

Buy KRT23-keratin 23 (histone deacetylase inducible) Gene now

Add to cart