Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
POLR3K-polymerase (RNA) III (DNA directed) polypeptide K, 12.3 kDa Gene
PTXBC011932
New product
Data sheet of POLR3K-polymerase (RNA) III (DNA directed) polypeptide K, 12.3 kDa Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about POLR3K-polymerase (RNA) III (DNA directed) polypeptide K, 12.3 kDa Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC011932 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | POLR3K |
| Origin species: | Human |
| Product name: | POLR3K-polymerase (RNA) III (DNA directed) polypeptide K, 12.3 kDa Gene |
| Size: | 2ug |
| Accessions: | BC011932 |
| Gene id: | 51728 |
| Gene description: | polymerase (RNA) III (DNA directed) polypeptide K, 12.3 kDa |
| Synonyms: | C11; C11-RNP3; My010; RPC10; RPC11; RPC12.5; DNA-directed RNA polymerase III subunit RPC10; DNA-directed RNA polymerase III subunit K; DNA-directed RNA polymerases III 12.5 kDa polypeptide; RNA polymerase III 12.5 kDa subunit; RNA polymerase III subunit C10; RNA polymerase III subunit C11; RNA polymerase III subunit CII; polymerase (RNA) III (DNA directed) polypeptide K, 12.3 kDa; polymerase (RNA) III subunit K; RNA polymerase III subunit K |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctgctgttctgccccggctgcgggaacgggctgatcgtggaggagggacaacgctgccaccgcttcgcctgcaacacgtgcccctacgtgcacaacatcacccgcaaggtaacaaatcggaagtacccaaaactgaaagaagtggatgatgtgcttggtggagcagctgcctgggagaatgttgactctactgcagagtcgtgtcccaaatgcgaacatcctcgtgcttacttcatgcagcttcagacccgctctgcagatgagccgatgaccaccttctacaagtgctgcaatgctcagtgtggacaccgctggagggattag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - LSM4 homolog, U6 small nuclear RNA associated (S. cerevisiae) - myosin, light chain 6B, alkali, smooth muscle and non-muscle - proline-serine-threonine phosphatase interacting protein 2 - serpin peptidase inhibitor, clade B (ovalbumin), member 1 |