No products
Prices are tax excluded
PTXBC008450
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC008450 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SUMO2 |
| Origin species: | Human |
| Product name: | SUMO2-SMT3 suppressor of mif two 3 homolog 2 (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC008450 |
| Gene id: | 6613 |
| Gene description: | SMT3 suppressor of mif two 3 homolog 2 (S. cerevisiae) |
| Synonyms: | HSMT3; SMT3B; SMT3H2; SUMO3; Smt3A; small ubiquitin-related modifier 2; SMT3 homolog 2; SMT3 suppressor of mif two 3 homolog 2; sentrin 2; ubiquitin-like protein SMT3A; ubiquitin-like protein SMT3B; small ubiquitin-like modifier 2 |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggccgacgaaaagcccaaggaaggagtcaagactgagaacaacaatcatattaatttgaaggtggcggggcaggatggttctgtggtgcagtttaagattaagaggcatacaccacttagtaaactaatgaaagcctattgtgaacgacagggattgtcaatgaggcagatcagattccgatttgacgggcaaccaatcaatgaaacagacacacctgcacagttggaaatggaggatgaagatacaattgatgtgttccaacagcagacgggaggtgtctactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - potassium voltage-gated channel, subfamily G, member 1 - cytochrome P450, family 2, subfamily J, polypeptide 2 - immunoglobulin heavy variable 7-81 (non-functional) - DDI1, DNA-damage inducible 1, homolog 2 (S. cerevisiae) |