LOC389458-hypothetical LOC389458 Gene View larger

LOC389458-hypothetical LOC389458 Gene

PTXBC031661

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LOC389458-hypothetical LOC389458 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about LOC389458-hypothetical LOC389458 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC031661
Product type: DNA & cDNA
Ncbi symbol: LOC389458
Origin species: Human
Product name: LOC389458-hypothetical LOC389458 Gene
Size: 2ug
Accessions: BC031661
Gene id: 389458
Gene description: hypothetical LOC389458
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctaacacccaggaagtccttcagaacctgctccaaggcgtcggggctggcggagacggagagctgcgggcagactcacacctggccccgggctctggctgtattgatggggctgtggtggccacgcgaccagaaagccggggaggaagacctgcggttccgtgagaggcgtccagggctgcaggccacggcgacaggctccggggaacatggggctttccctgtccactcccaaggagtgtgggcctcaacgcattggcaggggacggccgtgtgccctctccagaccccacccccagatgcatttattagaaataataaagttctttcttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - hypothetical LOC554206
- zinc finger protein 585A
- tumor protein D52-like 3
- heat shock 70kDa protein 4

Buy LOC389458-hypothetical LOC389458 Gene now

Add to cart