LOC554206-hypothetical LOC554206 Gene View larger

LOC554206-hypothetical LOC554206 Gene

PTXBC029609

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LOC554206-hypothetical LOC554206 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about LOC554206-hypothetical LOC554206 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC029609
Product type: DNA & cDNA
Ncbi symbol: LOC554206
Origin species: Human
Product name: LOC554206-hypothetical LOC554206 Gene
Size: 2ug
Accessions: BC029609
Gene id: 554206
Gene description: hypothetical LOC554206
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtctggcggacacagctccccggaacctccacgcccatggccactagacagagggagtcttccttcacctcctgcttttccacctggaattgcgacgcgggcgacgagggcatgggctgcacctgcgaagatgcttccttgtgcaagaagcgcctgtcgggcgcgggattcggggctggcatctgggacgcgggctgaggtgggaggcgggcctgcatctgaagaatacgctcggaggctggcaggttgctgcccccgcctcgcacgaccctcgcttcccacctgtgaaatgcacagaacagggcttcatttatttaacgaatcgtttctgagctcctgctgtgagccaggcttggagcaagcctgggtactgtggatgggagcaggcccctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - zinc finger protein 585A
- tumor protein D52-like 3
- heat shock 70kDa protein 4
- tumor protein D52-like 2

Buy LOC554206-hypothetical LOC554206 Gene now

Add to cart