Cart 4 Product Products 818,93 € (empty)
No products
To be determined Shipping
818,93 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 4 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 818,93 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 818,93 €
Data sheet of HSPA4-heat shock 70kDa protein 4 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about HSPA4-heat shock 70kDa protein 4 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC002526 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | HSPA4 |
| Origin species: | Human |
| Product name: | HSPA4-heat shock 70kDa protein 4 Gene |
| Size: | 2ug |
| Accessions: | BC002526 |
| Gene id: | 3308 |
| Gene description: | heat shock 70kDa protein 4 |
| Synonyms: | APG-2; HEL-S-5a; HS24/P52; HSPH2; hsp70; hsp70RY; heat shock 70 kDa protein 4; epididymis secretory sperm binding protein Li 5a; heat shock 70-related protein APG-2; heat shock 70kD protein 4; heat shock 70kDa protein 4; heat shock protein, 110 kDa; hsp70 RY; heat shock protein family A (Hsp70) member 4 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcggtggtgggcatagacctgggcttccagagctgctacgtcgctgtggcccgcgccggcggcatcgagactatcgctaatgagtatagcgaccgctgcacgccggcttgcatttcttttggtcctaagaatcgttcaattggagcagcagctaaaagccaggtaatttctaatgcaaagaacacagtccaaggatttaaaagattccatggccgagcattctctgatccatttgtggaggcagaaaaatctaaccttgcatatgatattgtgcagttgcctacaggattaacaggtataaaggtgacatatatggaggaagagcagaatggaccagtggatggacaaggagacaacccaggcccccaggctgctgagcagggtacagacacagctgtgccttcggattcagacaagaagcttcctgaaatggacattgattga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - tumor protein D52-like 2 - cytochrome b5 reductase 2 - ring finger protein 113B - MAS-related GPR, member F |