TPD52L3-tumor protein D52-like 3 Gene

View larger

TPD52L3-tumor protein D52-like 3 Gene

Reference: PTXBC033792

Condition: New product

Print

Data sheet of TPD52L3-tumor protein D52-like 3 Gene

Brand	ProteoGenix
Product type	DNA & cDNA
Origin species	Human

More info about TPD52L3-tumor protein D52-like 3 Gene

Brand:	ProteoGenix
Proteogenix catalog:	PTXBC033792
Product type:	DNA & cDNA
Ncbi symbol:	TPD52L3
Origin species:	Human
Product name:	TPD52L3-tumor protein D52-like 3 Gene
Size:	2ug
Accessions:	BC033792
Gene id:	89882
Gene description:	tumor protein D52-like 3
Synonyms:	NYDSP25; tumor protein D55; protein kinase NYD-SP25; testis development protein NYD-SP25; testis tissue sperm-binding protein Li 87P; tumor protein D52 like 3
Sequence primers:	Forward primer M13R (5'â†’3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â†’3'): TAATACGACTCACTATAGG
Orf sequence:	atgccacatgccaggacagagacctctgtgggcacatatgaatcccactcgacttctgaactggaggatctgacagagcccgagcaaagagagctcaaaaccaaactcactaaattggaggctgaaattgtaaccctacgccacgtactggcagccaaagagagacgctgtggggaactcaagaggaagttaggcctcaccgccttggtagggctgagacagaatctgtccaagagctggcttgatgttcaggtctccaacacctatgtgaaacagaagacatcagctgctctgtccaccatgggcactctcatctgcaggaagcttggaggcgtgaagaagtcggccacactcagatcttttgaaggattgatcttcaataaatacacgttaaatcaaggaaggaattaa
Vector:	pDONR223
Delivery lead time in business days in europe:	10-12 days
Storage:	-20â„ƒ
Delivery condition:	Blue Ice
Related products:	- heat shock 70kDa protein 4 - tumor protein D52-like 2 - cytochrome b5 reductase 2 - ring finger protein 113B

Reviews

Be the first to write your review !

Buy TPD52L3-tumor protein D52-like 3 Gene now