RPS15A-ribosomal protein S15a Gene View larger

RPS15A-ribosomal protein S15a Gene

PTXBC001697

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RPS15A-ribosomal protein S15a Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RPS15A-ribosomal protein S15a Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001697
Product type: DNA & cDNA
Ncbi symbol: RPS15A
Origin species: Human
Product name: RPS15A-ribosomal protein S15a Gene
Size: 2ug
Accessions: BC001697
Gene id: 6210
Gene description: ribosomal protein S15a
Synonyms: S15a; 40S ribosomal protein S15a; up-regulated by HBV X protein; ribosomal protein S15a
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtgcgcatgaatgtcctggcagatgctctcaagagtatcaacaatgccgaaaagagaggcaaacgccaggtgcttattaggccgtgctccaaagtcatcgtccggtttctcactgtgatgatgaagcatggttacattggcgaatttgaaatcattgatgaccacagagctgggaaaattgttgtgaacctcacaggcaggctaaacaagtgtggggtgatcagccccagatctgacgtgcaactcaaagacctggaaaaatggcagaataatctgcttccatcccgccagtttggtttcattgtactgacaacctcagctggcatcatggaccatgaagaagcaagacgaaaacacacaggagggaaaatcctgggattctttttctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ribosomal protein L37a
- acyl-CoA thioesterase 4
- AKT interacting protein
- POU class 2 homeobox 2

Buy RPS15A-ribosomal protein S15a Gene now

Add to cart