RPL37A-ribosomal protein L37a Gene View larger

RPL37A-ribosomal protein L37a Gene

PTXBC014262

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RPL37A-ribosomal protein L37a Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RPL37A-ribosomal protein L37a Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014262
Product type: DNA & cDNA
Ncbi symbol: RPL37A
Origin species: Human
Product name: RPL37A-ribosomal protein L37a Gene
Size: 2ug
Accessions: BC014262
Gene id: 6168
Gene description: ribosomal protein L37a
Synonyms: L37A; 60S ribosomal protein L37a
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccaaacgtaccaagaaagtcgggatcgtcggtaaatacgggacccgctatggggcctccctccggaaaatggtgaagaaaattgaaatcagccagcacgccaagtacacttgctctttctgtggcaaaaccaagatgaagagacgagctgtggggatctggcactgtggttcctgcatgaagacagtggctggcggtgcctggacgtacaataccacttccgctgtcacggtaaagtccgccatcagaagactgaaggagttgaaagaccagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - acyl-CoA thioesterase 4
- AKT interacting protein
- POU class 2 homeobox 2
- PHD finger protein 21A

Buy RPL37A-ribosomal protein L37a Gene now

Add to cart