Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of ACOT4-acyl-CoA thioesterase 4 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ACOT4-acyl-CoA thioesterase 4 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC031799 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ACOT4 |
| Origin species: | Human |
| Product name: | ACOT4-acyl-CoA thioesterase 4 Gene |
| Size: | 2ug |
| Accessions: | BC031799 |
| Gene id: | 122970 |
| Gene description: | acyl-CoA thioesterase 4 |
| Synonyms: | PTE-Ib; PTE1B; PTE2B; acyl-coenzyme A thioesterase 4; PTE-2b; peroxisomal acyl coenzyme A thioester hydrolase Ib; peroxisomal acyl-CoA thioesterase 2B; peroxisomal long-chain acyl-CoA thioesterase Ib; acyl-CoA thioesterase 4 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggacaacatatccctggagtacttcgaagaagccgtatgctacatgcttcaacatccccaggtaaaaggcccaggcattgggcttttgggcatttctctaggagctgatatttgtctctcaatggcctcattcttgaagaatgtctcagccacagtttccatcaatggatctgggatcagtgggaacacagccatcaactataagcacagtagcattccaccattgggctatgacctgaggagaatcaaggtagctttctcaggcctcgtggacatcgtggatataaggaatgctctcgtaggagggtacaagaaccccagcatgattccaatagagaaggcccaggggcccatcctgctcattgttggtcaggatgaccataactggagaagtgagttgtatgcccaaacagtctctgaacggttacaggcccatggaaaggaaaaaccccagatcatctgttaccctgggactgggcattacatcgagcctccttacttccccctgtgcccagcttcccttcacagattactgaacaaacatgttatatggggtggggagcccagggctcattctaaggcccaggaagatgcctggaagcaaattctagccttcttctgcaaacacctgggaggtacccagaaaacagctgtccctaaattgtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - AKT interacting protein - POU class 2 homeobox 2 - PHD finger protein 21A - prion protein 2 (dublet) |