POU2F2-POU class 2 homeobox 2 Gene View larger

POU2F2-POU class 2 homeobox 2 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of POU2F2-POU class 2 homeobox 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about POU2F2-POU class 2 homeobox 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC006101
Product type: DNA & cDNA
Ncbi symbol: POU2F2
Origin species: Human
Product name: POU2F2-POU class 2 homeobox 2 Gene
Size: 2ug
Accessions: BC006101
Gene id: 5452
Gene description: POU class 2 homeobox 2
Synonyms: OCT2; OTF2; Oct-2; POU domain, class 2, transcription factor 2; OTF-2; homeobox protein; lymphoid-restricted immunoglobulin octamer-binding protein NF-A2; octamer-binding protein 2; octamer-binding transcription factor 2; POU class 2 homeobox 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggttcactccagcatgggggctccagaaataagaatgtctaagcccctggaggccgagaagcaaggtctggactccccatcagagcacacagacaccgaaagaaatggaccagacactaatcatcagaacccccaaaataagacctccccattctccgtgtccccaactggccccagtacaaagatcaaggctgaagaccccagtggcgattcagccccagcagcacccctgccccctcagccggcccagcctcatctgccccaggcccaactcatgttgacgggcagccagctagctggggacatacagcagctcctccagctccagcagctggtgcttgtgccaggccaccacctccagccacctgctcagttcctgctaccgcaggcccagcagagccagccaggcctgctaccgacaccaaatctattccagctacctcagcaaacccagggagctcttctgacctcccagccccgggccgggcttcccacacagccccccaaatgcttggagccaccatcccaccccgaggagcccagtgatctggaggagctggagcaattcgcccgcaccttcaagcaacgccgcatcaagctgggcttcacgcagggtgatgtgggcctggccatgggcaagctctacggcaacgacttcagccagacgaccatttcccgcttcgaggccctcaacctgagcttcaagaacatgtgcaaactcaagcccctcctggagaagtggctcaacgatgcagagactatgtctgtggactcaagcctgcccagccccaaccagctgagcagccccagcctgggtttcgacggcctgcccggccggagacgcaagaagaggaccagcatcgagacaaacgtccgcttcgccttagagaagagttttctagcgaaccagaagcctacctcagaggagatcctgctgatcgccgagcagctgcacatggagaaggaagtgatccgcgtctggttctgcaaccggcgccagaaggagaaacgcatcaacccctgcagtgcggcccccatgctgcccagcccagggaagccggccagctacagcccccatatggtcacaccccaagggggcgcggggaccttaccgttgtcccaagcttccagcagtctgagcacaacagcacaaaccccagccctcaaggcagccactcggctatcggcttgtcaggcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - PHD finger protein 21A
- prion protein 2 (dublet)
- SH3-domain GRB2-like 3
- deleted in azoospermia 4

Buy POU2F2-POU class 2 homeobox 2 Gene now

Add to cart