Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
COX6B1-cytochrome c oxidase subunit Vib polypeptide 1 (ubiquitous) Gene
PTXBC001015
New product
Data sheet of COX6B1-cytochrome c oxidase subunit Vib polypeptide 1 (ubiquitous) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about COX6B1-cytochrome c oxidase subunit Vib polypeptide 1 (ubiquitous) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001015 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | COX6B1 |
| Origin species: | Human |
| Product name: | COX6B1-cytochrome c oxidase subunit Vib polypeptide 1 (ubiquitous) Gene |
| Size: | 2ug |
| Accessions: | BC001015 |
| Gene id: | 1340 |
| Gene description: | cytochrome c oxidase subunit Vib polypeptide 1 (ubiquitous) |
| Synonyms: | COX6B; COXG; COXVIb1; cytochrome c oxidase subunit 6B1; COX VIb-1; cytochrome c oxidase subunit VIb polypeptide 1 (ubiquitous) |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggaagacatggagaccaaaatcaagaactacaagaccgccccttttgacagccgcttccccaaccagaaccagactagaaactgctggcagaactacctggacttccaccgctgtcagaaggcaatgaccgctaaaggaggcgatatctctgtgtgcgaatggtaccagcgtgtgtaccagtccctctgccccacatcctgggtcacagactgggatgagcaacgggctgaaggcacgtttcccgggaagatctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - pro-platelet basic protein (chemokine (C-X-C motif) ligand 7) - NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 2, 8kDa - proteasome (prosome, macropain) 26S subunit, non-ATPase, 14 - polymerase (RNA) III (DNA directed) polypeptide K, 12.3 kDa |