Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
NDUFA2-NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 2, 8kDa Gene
PTXBC003674
New product
Data sheet of NDUFA2-NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 2, 8kDa Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about NDUFA2-NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 2, 8kDa Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC003674 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NDUFA2 |
| Origin species: | Human |
| Product name: | NDUFA2-NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 2, 8kDa Gene |
| Size: | 2ug |
| Accessions: | BC003674 |
| Gene id: | 4695 |
| Gene description: | NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 2, 8kDa |
| Synonyms: | CD14; CIB8; NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 2; NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 2, 8kDa; NADH-ubiquinone oxidoreductase subunit CI-B8; complex I B8 subunit; NADH:ubiquinone oxidoreductase subunit A2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggcggccgcagcaagtcgaggagtcggggcaaagctgggcctgcgtgagattcgcatccacttatgtcagcgctcgcccggcagccagggcgtcagggacttcattgagaaacgctacgtggagctgaagaaggcgaatcccgacctacccatcctaatccgcgaatgctccgatgtgcagcccaagctctgggcccgctacgcatttggccaagagacgaatgtccctttgaacaacttcagtgctgatcaggtaaccagagccctggagaacgttctaagtggtaaagcctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - proteasome (prosome, macropain) 26S subunit, non-ATPase, 14 - polymerase (RNA) III (DNA directed) polypeptide K, 12.3 kDa - LSM4 homolog, U6 small nuclear RNA associated (S. cerevisiae) - myosin, light chain 6B, alkali, smooth muscle and non-muscle |