PPBP-pro-platelet basic protein (chemokine (C-X-C motif) ligand 7) Gene View larger

PPBP-pro-platelet basic protein (chemokine (C-X-C motif) ligand 7) Gene

PTXBC028217

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PPBP-pro-platelet basic protein (chemokine (C-X-C motif) ligand 7) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PPBP-pro-platelet basic protein (chemokine (C-X-C motif) ligand 7) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC028217
Product type: DNA & cDNA
Ncbi symbol: PPBP
Origin species: Human
Product name: PPBP-pro-platelet basic protein (chemokine (C-X-C motif) ligand 7) Gene
Size: 2ug
Accessions: BC028217
Gene id: 5473
Gene description: pro-platelet basic protein (chemokine (C-X-C motif) ligand 7)
Synonyms: B-TG1; Beta-TG; CTAP-III; CTAP3; CTAPIII; CXCL7; LA-PF4; LDGF; MDGF; NAP-2; PBP; SCYB7; TC1; TC2; TGB; TGB1; THBGB; THBGB1; platelet basic protein; C-X-C motif chemokine 7; CXC chemokine ligand 7; beta-thromboglobulin; chemokine (C-X-C motif) ligand 7; connective tissue-activating peptide III; leukocyte-derived growth factor; low-affinity platelet factor IV; macrophage-derived growth factor; neutrophil-activating peptide 2; small inducible cytokine B7; small inducible cytokine subfamily B, member 7; thrombocidin 1; thrombocidin 2; thromboglobulin, beta-1; pro-platelet basic protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagcctcagacttgataccaccccttcctgtaacagtgcgagaccacttcatgccttgcaggtgctgctgcttctgtcattgctgctgactgctctggcttcctccaccaaaggacaaactaagagaaacttggcgaaaggcaaagaggaaagtctagacagtgacttgtatgctgaactccgctgcatgtgtataaagacaacctctggaattcatcccaaaaacatccaaagtttggaagtgatcgggaaaggaacccattgcaaccaagtcgaagtgatagccacactgaaggatgggaggaaaatctgcctggacccagatgctcccagaatcaagaaaattgtacagaaaaaattggcaggtgatgaatctgctgattaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 2, 8kDa
- proteasome (prosome, macropain) 26S subunit, non-ATPase, 14
- polymerase (RNA) III (DNA directed) polypeptide K, 12.3 kDa
- LSM4 homolog, U6 small nuclear RNA associated (S. cerevisiae)

Buy PPBP-pro-platelet basic protein (chemokine (C-X-C motif) ligand 7) Gene now

Add to cart