Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
PPBP-pro-platelet basic protein (chemokine (C-X-C motif) ligand 7) Gene
PTXBC028217
New product
Data sheet of PPBP-pro-platelet basic protein (chemokine (C-X-C motif) ligand 7) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PPBP-pro-platelet basic protein (chemokine (C-X-C motif) ligand 7) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC028217 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PPBP |
| Origin species: | Human |
| Product name: | PPBP-pro-platelet basic protein (chemokine (C-X-C motif) ligand 7) Gene |
| Size: | 2ug |
| Accessions: | BC028217 |
| Gene id: | 5473 |
| Gene description: | pro-platelet basic protein (chemokine (C-X-C motif) ligand 7) |
| Synonyms: | B-TG1; Beta-TG; CTAP-III; CTAP3; CTAPIII; CXCL7; LA-PF4; LDGF; MDGF; NAP-2; PBP; SCYB7; TC1; TC2; TGB; TGB1; THBGB; THBGB1; platelet basic protein; C-X-C motif chemokine 7; CXC chemokine ligand 7; beta-thromboglobulin; chemokine (C-X-C motif) ligand 7; connective tissue-activating peptide III; leukocyte-derived growth factor; low-affinity platelet factor IV; macrophage-derived growth factor; neutrophil-activating peptide 2; small inducible cytokine B7; small inducible cytokine subfamily B, member 7; thrombocidin 1; thrombocidin 2; thromboglobulin, beta-1; pro-platelet basic protein |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagcctcagacttgataccaccccttcctgtaacagtgcgagaccacttcatgccttgcaggtgctgctgcttctgtcattgctgctgactgctctggcttcctccaccaaaggacaaactaagagaaacttggcgaaaggcaaagaggaaagtctagacagtgacttgtatgctgaactccgctgcatgtgtataaagacaacctctggaattcatcccaaaaacatccaaagtttggaagtgatcgggaaaggaacccattgcaaccaagtcgaagtgatagccacactgaaggatgggaggaaaatctgcctggacccagatgctcccagaatcaagaaaattgtacagaaaaaattggcaggtgatgaatctgctgattaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 2, 8kDa - proteasome (prosome, macropain) 26S subunit, non-ATPase, 14 - polymerase (RNA) III (DNA directed) polypeptide K, 12.3 kDa - LSM4 homolog, U6 small nuclear RNA associated (S. cerevisiae) |