No products
Prices are tax excluded
PTXBC034248
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC034248 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NBR2 |
| Origin species: | Human |
| Product name: | NBR2-neighbor of BRCA1 gene 2 Gene |
| Size: | 2ug |
| Accessions: | BC034248 |
| Gene id: | 10230 |
| Gene description: | neighbor of BRCA1 gene 2 |
| Synonyms: | NCRNA00192; neighbor of BRCA1 gene 2 (non-protein coding) |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtggaaaggaggtagaagtcatcctttcctcccctgtagcagcaggcgtgcaggctctggtggtcagctggactccatactcccccaccagtcaccagcctggggaccgtggggctgcaaggacctcagcagcggtgtcccaagtttcctgacttcttccatcctctggaaatcagctgtggtaaagtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - ribosomal protein S15a - ribosomal protein L37a - acyl-CoA thioesterase 4 - AKT interacting protein |