NBR2-neighbor of BRCA1 gene 2 Gene View larger

NBR2-neighbor of BRCA1 gene 2 Gene

PTXBC034248

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NBR2-neighbor of BRCA1 gene 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about NBR2-neighbor of BRCA1 gene 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC034248
Product type: DNA & cDNA
Ncbi symbol: NBR2
Origin species: Human
Product name: NBR2-neighbor of BRCA1 gene 2 Gene
Size: 2ug
Accessions: BC034248
Gene id: 10230
Gene description: neighbor of BRCA1 gene 2
Synonyms: NCRNA00192; neighbor of BRCA1 gene 2 (non-protein coding)
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtggaaaggaggtagaagtcatcctttcctcccctgtagcagcaggcgtgcaggctctggtggtcagctggactccatactcccccaccagtcaccagcctggggaccgtggggctgcaaggacctcagcagcggtgtcccaagtttcctgacttcttccatcctctggaaatcagctgtggtaaagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ribosomal protein S15a
- ribosomal protein L37a
- acyl-CoA thioesterase 4
- AKT interacting protein

Buy NBR2-neighbor of BRCA1 gene 2 Gene now

Add to cart