MARK4-MAP/microtubule affinity-regulating kinase 4 Gene View larger

MARK4-MAP/microtubule affinity-regulating kinase 4 Gene

PTXBC009049

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MARK4-MAP/microtubule affinity-regulating kinase 4 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MARK4-MAP/microtubule affinity-regulating kinase 4 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009049
Product type: DNA & cDNA
Ncbi symbol: MARK4
Origin species: Human
Product name: MARK4-MAP/microtubule affinity-regulating kinase 4 Gene
Size: 2ug
Accessions: BC009049
Gene id: 57787
Gene description: MAP/microtubule affinity-regulating kinase 4
Synonyms: MARK4 serine/threonine protein kinase; MARK4L; MARK4S; MARKL1; MARKL1L; PAR-1D; MAP/microtubule affinity-regulating kinase 4; MAP/microtubule affinity-regulating kinase like 1; microtubule affinity regulating kinase 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcagctctgcgccaggccacagcagccgcccgctgccgctgccgccagccacagccgttcctgctggcctgcctgcacgggggtgcgggcgggcccgagcccctgtcccacttcgaagtggaggtctgccagctgccccggccaggcttgcggggagttctcttccgccgtgtggcgggcaccgccctggccttccgcaccctcgtcacccgcatctccaacgacctcgagctctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - hydroxysteroid (17-beta) dehydrogenase 12
- aldehyde dehydrogenase 1 family, member A3
- interferon stimulated exonuclease gene 20kDa
- acylphosphatase 1, erythrocyte (common) type

Buy MARK4-MAP/microtubule affinity-regulating kinase 4 Gene now

Add to cart