Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of ISG20-interferon stimulated exonuclease gene 20kDa Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ISG20-interferon stimulated exonuclease gene 20kDa Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC016341 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ISG20 |
| Origin species: | Human |
| Product name: | ISG20-interferon stimulated exonuclease gene 20kDa Gene |
| Size: | 2ug |
| Accessions: | BC016341 |
| Gene id: | 3669 |
| Gene description: | interferon stimulated exonuclease gene 20kDa |
| Synonyms: | promyelocytic leukemia nuclear body-associated protein ISG20; CD25; HEM45; interferon-stimulated gene 20 kDa protein; estrogen-regulated transcript 45 protein; interferon stimulated exonuclease gene 20kDa; interferon stimulated exonuclease gene 20 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctgggagccgtgaggtggtggccatggactgcgagatggtggggctggggccccaccgggagagtggcctggctcgttgcagcctcgtgaacgtccacggtgctgtgctgtacgacaagttcatccggcctgagggagagatcaccgattacagaacccgggtcagcggggtcacccctcagcacatggtgggggccacaccatttgccgtggccaggctagaggtccccttcccatcctctccaacggcagctgtgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - acylphosphatase 1, erythrocyte (common) type - nuclear cap binding protein subunit 2, 20kDa - alkB, alkylation repair homolog 3 (E. coli) - hydroxysteroid (17-beta) dehydrogenase 10 |