ISG20-interferon stimulated exonuclease gene 20kDa Gene View larger

ISG20-interferon stimulated exonuclease gene 20kDa Gene

PTXBC016341

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ISG20-interferon stimulated exonuclease gene 20kDa Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ISG20-interferon stimulated exonuclease gene 20kDa Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC016341
Product type: DNA & cDNA
Ncbi symbol: ISG20
Origin species: Human
Product name: ISG20-interferon stimulated exonuclease gene 20kDa Gene
Size: 2ug
Accessions: BC016341
Gene id: 3669
Gene description: interferon stimulated exonuclease gene 20kDa
Synonyms: promyelocytic leukemia nuclear body-associated protein ISG20; CD25; HEM45; interferon-stimulated gene 20 kDa protein; estrogen-regulated transcript 45 protein; interferon stimulated exonuclease gene 20kDa; interferon stimulated exonuclease gene 20
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctgggagccgtgaggtggtggccatggactgcgagatggtggggctggggccccaccgggagagtggcctggctcgttgcagcctcgtgaacgtccacggtgctgtgctgtacgacaagttcatccggcctgagggagagatcaccgattacagaacccgggtcagcggggtcacccctcagcacatggtgggggccacaccatttgccgtggccaggctagaggtccccttcccatcctctccaacggcagctgtgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - acylphosphatase 1, erythrocyte (common) type
- nuclear cap binding protein subunit 2, 20kDa
- alkB, alkylation repair homolog 3 (E. coli)
- hydroxysteroid (17-beta) dehydrogenase 10

Buy ISG20-interferon stimulated exonuclease gene 20kDa Gene now

Add to cart