ALDH1A3-aldehyde dehydrogenase 1 family, member A3 Gene View larger

ALDH1A3-aldehyde dehydrogenase 1 family, member A3 Gene

PTXBC009245

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ALDH1A3-aldehyde dehydrogenase 1 family, member A3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ALDH1A3-aldehyde dehydrogenase 1 family, member A3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009245
Product type: DNA & cDNA
Ncbi symbol: ALDH1A3
Origin species: Human
Product name: ALDH1A3-aldehyde dehydrogenase 1 family, member A3 Gene
Size: 2ug
Accessions: BC009245
Gene id: 220
Gene description: aldehyde dehydrogenase 1 family, member A3
Synonyms: ALDH1A6; ALDH6; MCOP8; RALDH3; aldehyde dehydrogenase family 1 member A3; acetaldehyde dehydrogenase 6; aldehyde dehydrogenase 6; retinaldehyde dehydrogenase 3; aldehyde dehydrogenase 1 family member A3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccaccgctaacggggccgtggaaaacgggcagccggacaggaagccgccggccctgccgcgccccatccgcaacctggaggtcaagttcaccaaggtgaggcgggcgcccctcccacccgacggccgcgggcccctgcgctgggcagccagactcggggcggcgggggcgagggagcagcgggccgggggtccgccgggcgccgccgagacccgagcctccctgcccgggcgcggctctccagaaaccgcacctttcgcgggacgtctcgggcgggatcgcaggcggcggggctcggcgctgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - interferon stimulated exonuclease gene 20kDa
- acylphosphatase 1, erythrocyte (common) type
- nuclear cap binding protein subunit 2, 20kDa
- alkB, alkylation repair homolog 3 (E. coli)

Buy ALDH1A3-aldehyde dehydrogenase 1 family, member A3 Gene now

Add to cart