HSD17B12-hydroxysteroid (17-beta) dehydrogenase 12 Gene View larger

HSD17B12-hydroxysteroid (17-beta) dehydrogenase 12 Gene

PTXBC012536

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HSD17B12-hydroxysteroid (17-beta) dehydrogenase 12 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about HSD17B12-hydroxysteroid (17-beta) dehydrogenase 12 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012536
Product type: DNA & cDNA
Ncbi symbol: HSD17B12
Origin species: Human
Product name: HSD17B12-hydroxysteroid (17-beta) dehydrogenase 12 Gene
Size: 2ug
Accessions: BC012536
Gene id: 51144
Gene description: hydroxysteroid (17-beta) dehydrogenase 12
Synonyms: KAR; SDR12C1; very-long-chain 3-oxoacyl-CoA reductase; 17-beta-HSD 12; 17-beta-hydroxysteroid dehydrogenase 12; 17beta-HSD type 12; 3-ketoacyl-CoA reductase; estradiol 17-beta-dehydrogenase 12; short chain dehydrogenase/reductase family 12C member 1; steroid dehydrogenase homolog; hydroxysteroid 17-beta dehydrogenase 12
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagagcgctctccccgccgccggcttcctgtactgggtcggcgcgggcaccgtggcctacctagccctgcgtatttcgtactcgctcttcacggccctccgggtctggggagtggggaatgaggcgggggtcggcccggggctcggagaatgggcagttgtcacaggtagtactgatggaattggaaaatcatatgcagaagagttagcaaagcatggaatgaaggttgtccttatcagcagatcaaaggataaacttgaccaggtttccagtgaaataagcaattatacttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - aldehyde dehydrogenase 1 family, member A3
- interferon stimulated exonuclease gene 20kDa
- acylphosphatase 1, erythrocyte (common) type
- nuclear cap binding protein subunit 2, 20kDa

Buy HSD17B12-hydroxysteroid (17-beta) dehydrogenase 12 Gene now

Add to cart