DHX37-DEAH (Asp-Glu-Ala-His) box polypeptide 37 Gene View larger

DHX37-DEAH (Asp-Glu-Ala-His) box polypeptide 37 Gene

PTXBC004463

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DHX37-DEAH (Asp-Glu-Ala-His) box polypeptide 37 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about DHX37-DEAH (Asp-Glu-Ala-His) box polypeptide 37 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC004463
Product type: DNA & cDNA
Ncbi symbol: DHX37
Origin species: Human
Product name: DHX37-DEAH (Asp-Glu-Ala-His) box polypeptide 37 Gene
Size: 2ug
Accessions: BC004463
Gene id: 57647
Gene description: DEAH (Asp-Glu-Ala-His) box polypeptide 37
Synonyms: DDX37; DEAD/DEAH box helicase DDX37; DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 37; DEAH (Asp-Glu-Ala-His) box polypeptide 37; DEAH box protein 37; DEAH-box helicase 37
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggcttcgtggcctgctctcaggaagtgggtcaagccctgggaaccctcatccatgagagctcgatcccgtatgaagggtgctgccgcccgtgccatctggcccgggggtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - microfibrillar-associated protein 3-like
- neuropilin (NRP) and tolloid (TLL)-like 2
- zinc finger and BTB domain containing 24
- emopamil binding protein (sterol isomerase)

Buy DHX37-DEAH (Asp-Glu-Ala-His) box polypeptide 37 Gene now

Add to cart