Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of DHX37-DEAH (Asp-Glu-Ala-His) box polypeptide 37 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about DHX37-DEAH (Asp-Glu-Ala-His) box polypeptide 37 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC004463 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | DHX37 |
| Origin species: | Human |
| Product name: | DHX37-DEAH (Asp-Glu-Ala-His) box polypeptide 37 Gene |
| Size: | 2ug |
| Accessions: | BC004463 |
| Gene id: | 57647 |
| Gene description: | DEAH (Asp-Glu-Ala-His) box polypeptide 37 |
| Synonyms: | DDX37; DEAD/DEAH box helicase DDX37; DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 37; DEAH (Asp-Glu-Ala-His) box polypeptide 37; DEAH box protein 37; DEAH-box helicase 37 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggcttcgtggcctgctctcaggaagtgggtcaagccctgggaaccctcatccatgagagctcgatcccgtatgaagggtgctgccgcccgtgccatctggcccgggggtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - microfibrillar-associated protein 3-like - neuropilin (NRP) and tolloid (TLL)-like 2 - zinc finger and BTB domain containing 24 - emopamil binding protein (sterol isomerase) |