FRMD8-FERM domain containing 8 Gene View larger

FRMD8-FERM domain containing 8 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FRMD8-FERM domain containing 8 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about FRMD8-FERM domain containing 8 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC033851
Product type: DNA & cDNA
Ncbi symbol: FRMD8
Origin species: Human
Product name: FRMD8-FERM domain containing 8 Gene
Size: 2ug
Accessions: BC033851
Gene id: 83786
Gene description: FERM domain containing 8
Synonyms: FKSG44; FERM domain-containing protein 8; FERM domain containing 8
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggacgggacagaaggcagtgccgggcagcccggccccgctgagcgatcccaccgaagcagcgtgtcctccgtgggagcccgaggtgggtcccacccgcatctcctcttccacaccctcctgggaccccagccctggagaagtagctctggcttgtcttctttttcattaaagataatttatgtatcgactaagaaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - zinc finger protein 273
- zinc finger protein 765
- cyclin-dependent kinase 6
- R3H domain containing 1

Buy FRMD8-FERM domain containing 8 Gene now

Add to cart