ZNF273-zinc finger protein 273 Gene View larger

ZNF273-zinc finger protein 273 Gene

PTXBC019234

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ZNF273-zinc finger protein 273 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ZNF273-zinc finger protein 273 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC019234
Product type: DNA & cDNA
Ncbi symbol: ZNF273
Origin species: Human
Product name: ZNF273-zinc finger protein 273 Gene
Size: 2ug
Accessions: BC019234
Gene id: 10793
Gene description: zinc finger protein 273
Synonyms: HZF9; zinc finger protein 273; zinc finger protein 9; zinc finger protein HZF9
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgttagataactacagaaacctggtcttcctgggtattgctgtctctaagccagacctgatcacttgtctggagcaaggaaaagagccctgcaatatgaagagacatgcgatggtagccaaacccccaggttggagtgcagtggcgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - zinc finger protein 765
- cyclin-dependent kinase 6
- R3H domain containing 1
- profilin family, member 4

Buy ZNF273-zinc finger protein 273 Gene now

Add to cart