R3HDM1-R3H domain containing 1 Gene View larger

R3HDM1-R3H domain containing 1 Gene

PTXBC001217

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of R3HDM1-R3H domain containing 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about R3HDM1-R3H domain containing 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001217
Product type: DNA & cDNA
Ncbi symbol: R3HDM1
Origin species: Human
Product name: R3HDM1-R3H domain containing 1 Gene
Size: 2ug
Accessions: BC001217
Gene id: 23518
Gene description: R3H domain containing 1
Synonyms: R3HDM; R3H domain-containing protein 1; R3H domain (binds single-stranded nucleic acids) containing; R3H domain containing 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaggatgtctgatactgttactgtaaaagatgaaactgcaacaatgaaggatttggaggcagaagtgaaagatacaaccagagttgaaaatcttatcaaatcagaaaactatgggaagattttggtagagaagaatgaacattgtattgagaacaatatagatttgcaggtaaacaggaatttttctctggctacaaatactaaatattcagtatatatttatgtttattttcatacaaaactcacttctcaaaattctaaaagggtaagttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - profilin family, member 4
- numb homolog (Drosophila)
- glycoprotein IX (platelet)
- 6-phosphogluconolactonase

Buy R3HDM1-R3H domain containing 1 Gene now

Add to cart