CDK6-cyclin-dependent kinase 6 Gene View larger

CDK6-cyclin-dependent kinase 6 Gene

PTXBC027989

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CDK6-cyclin-dependent kinase 6 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CDK6-cyclin-dependent kinase 6 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC027989
Product type: DNA & cDNA
Ncbi symbol: CDK6
Origin species: Human
Product name: CDK6-cyclin-dependent kinase 6 Gene
Size: 2ug
Accessions: BC027989
Gene id: 1021
Gene description: cyclin-dependent kinase 6
Synonyms: MCPH12; PLSTIRE; cyclin-dependent kinase 6; cell division protein kinase 6; serine/threonine-protein kinase PLSTIRE; cyclin dependent kinase 6
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaccaacatccccacacctctacatctctgtcccctgtatctcttcctttctaccactaaagtgttccctgctaccatcctggcttgtccacatggtgctctccatcttcctccacatcatggaccacaggtgtgcctgtctaggcctggccaccactcccaacttgacctagccacattcatctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - R3H domain containing 1
- profilin family, member 4
- numb homolog (Drosophila)
- glycoprotein IX (platelet)

Buy CDK6-cyclin-dependent kinase 6 Gene now

Add to cart