GRLF1-glucocorticoid receptor DNA binding factor 1 Gene View larger

GRLF1-glucocorticoid receptor DNA binding factor 1 Gene

PTXBC003514

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GRLF1-glucocorticoid receptor DNA binding factor 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GRLF1-glucocorticoid receptor DNA binding factor 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC003514
Product type: DNA & cDNA
Ncbi symbol: GRLF1
Origin species: Human
Product name: GRLF1-glucocorticoid receptor DNA binding factor 1 Gene
Size: 2ug
Accessions: BC003514
Gene id: 2909
Gene description: glucocorticoid receptor DNA binding factor 1
Synonyms: GRLF1; GRF-1; P190-A; P190A; p190ARhoGAP; p190RhoGAP; rho GTPase-activating protein 35; glucocorticoid receptor DNA-binding factor 1; glucocorticoid receptor repression factor 1; rho GAP p190A; Rho GTPase activating protein 35
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaggccaccagcaggagtgttcatggggatgtgggcgaggtggggcactttgaaggaatggcggtctgctggtgccctcgaaggggcatccttcctggtcttcgctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - carbonic anhydrase XIV (CA14) pseudogene
- MAP/microtubule affinity-regulating kinase 4
- hydroxysteroid (17-beta) dehydrogenase 12
- aldehyde dehydrogenase 1 family, member A3

Buy GRLF1-glucocorticoid receptor DNA binding factor 1 Gene now

Add to cart