LOC554207-hypothetical LOC554207 Gene View larger

LOC554207-hypothetical LOC554207 Gene

PTXBC031469

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LOC554207-hypothetical LOC554207 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about LOC554207-hypothetical LOC554207 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC031469
Product type: DNA & cDNA
Ncbi symbol: LOC554207
Origin species: Human
Product name: LOC554207-hypothetical LOC554207 Gene
Size: 2ug
Accessions: BC031469
Gene id: 554207
Gene description: hypothetical LOC554207
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgttccaccagattcttgttgggctcaagaagcattcaagcttcatcccccttcgtatttatgaaatccggaggtactggagcagcgctgtatgtccagcatctggcattgttcaatcaagatgttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - hypothetical LOC554202
- kelch domain containing 9
- hypothetical LOC389458
- hypothetical LOC554206

Buy LOC554207-hypothetical LOC554207 Gene now

Add to cart