LOC554202-hypothetical LOC554202 Gene View larger

LOC554202-hypothetical LOC554202 Gene

PTXBC021861

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LOC554202-hypothetical LOC554202 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about LOC554202-hypothetical LOC554202 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC021861
Product type: DNA & cDNA
Ncbi symbol: LOC554202
Origin species: Human
Product name: LOC554202-hypothetical LOC554202 Gene
Size: 2ug
Accessions: BC021861
Gene id: 554202
Gene description: hypothetical LOC554202
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggattcctggaaatacctcctcaaggccagtgtagagccctcaatcacccactgcccccagcttctccttctcccatctcctgcaccaagcaggtctccaggtgttccagctgctgatgacgtaaagtgtggagttggtccaggaaggtcatgttccatgcagcagaggagcgctttgtgtgagaagttgaagacctgctgtaacacatcatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - kelch domain containing 9
- hypothetical LOC389458
- hypothetical LOC554206
- zinc finger protein 585A

Buy LOC554202-hypothetical LOC554202 Gene now

Add to cart