PLA2G1B-phospholipase A2, group IB (pancreas) Gene View larger

PLA2G1B-phospholipase A2, group IB (pancreas) Gene

PTXBC005386

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PLA2G1B-phospholipase A2, group IB (pancreas) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PLA2G1B-phospholipase A2, group IB (pancreas) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005386
Product type: DNA & cDNA
Ncbi symbol: PLA2G1B
Origin species: Human
Product name: PLA2G1B-phospholipase A2, group IB (pancreas) Gene
Size: 2ug
Accessions: BC005386
Gene id: 5319
Gene description: phospholipase A2, group IB (pancreas)
Synonyms: PLA2; PLA2A; PPLA2; phospholipase A2; phosphatidylcholine 2-acylhydrolase 1B; phospholipase A2, group IB (pancreas); phospholipase A2 group IB
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaactccttgtgctagctgtgctgctcacagtggccgccgccgacagcggcatcagccctcgggccgtgtggcagttccgcaaaatgatcaagtgcgtgatcccggggagtgaccccttcttggaatacaacaactacggctgctactgtggcttggggggctcaggcacccccgtggatgaactggacaagcaaaaacaaagagtgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - NOP10 ribonucleoprotein homolog (yeast)
- dynein, light chain, roadblock-type 1
- synaptosomal-associated protein, 29kDa
- ependymin related protein 1 (zebrafish)

Buy PLA2G1B-phospholipase A2, group IB (pancreas) Gene now

Add to cart