Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of NOP10-NOP10 ribonucleoprotein homolog (yeast) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about NOP10-NOP10 ribonucleoprotein homolog (yeast) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC008886 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NOP10 |
| Origin species: | Human |
| Product name: | NOP10-NOP10 ribonucleoprotein homolog (yeast) Gene |
| Size: | 2ug |
| Accessions: | BC008886 |
| Gene id: | 55505 |
| Gene description: | NOP10 ribonucleoprotein homolog (yeast) |
| Synonyms: | NOP10 ribonucleoprotein; snoRNP protein NOP10; NOP10 ribonucleoprotein homolog; DKCB1; NOLA3; NOP10P; H/ACA ribonucleoprotein complex subunit 3; homolog of yeast Nop10p; nucleolar protein 10; nucleolar protein family A member 3; nucleolar protein family A, member 3 (H/ACA small nucleolar RNPs) |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtttctccagtattacctcaacgagcagggagatcgagtctatacgctgaagaaatttgacccgatgggacaacagacctgctcagcccatcctgctcggttctccccagatgacaaatactctcgacaccgaatcaccatcaagaaacgcttcaaggtgctcatgacccagcaaccgcgccctgtcctctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - dynein, light chain, roadblock-type 1 - synaptosomal-associated protein, 29kDa - ependymin related protein 1 (zebrafish) - HRAS-like suppressor family, member 5 |